Description :
From Genome Similarity Track
Location :
Scaffold_5:1350604- 1368105
Transcript NameFunction/comments
Physo_547613callose synthase, putative
Physo_562625GI18434
Physo_356392enhancer of yellow 2 homolog (Drosophila), isoform CRA_b
Physo_28785730S ribosomal protein S16, putative
Physo_353112nucleolar protein, putative
Physo_254379PREDICTED: lysosomal thioesterase PPT2
Physo_254363ankyrin repeat

Sequence
17501 bases(100 bases per row)
ATTGTCACGACGTTCGTGTACATGTACTGCAAGGTCTACATCGCCCTGTCCGGCGTGCAGACGCAGATTGTGTACAACATGAACACGACGGAGATCATCA
TGGACAACTCGGAGACCTACGGCTTCGACGACCGCGTGTACCACGACATGGACTCGGTGTACAACACGCAGTATTACATCCAGGCTGGTCTGTTCCTGTC
GCTGCCGCTGATTTGTGTGTACTTCGCTGAAATGGGTCTGCGTCGCGGTCTGGTGCAGTTCTTGGAGATGGTGTTCACGGCTGGCCCAGCGTTCTTCATC
TTCCAGCTGGGTACGACCATGCACTTTTTCGACAACAACCTTCTGCACGGTGAGGCTCAGTACAAGGCTACGGGTCGTGGCTTCAAGATCACTCGTGAGA
CGTTCGTGCTGCTGTACAAGGCTTACGCCCTGAGTCACTACCGCAAGGCCATGGAGCTCATCGGTCTGTGTTTGGTGTACCTGACGTTCGGCAAGTTCGA
CATCTGTGACACCTCTGTTGCTGGTGAGGAGAACTCGTTCGCGTTTGACTACTGTGAGACGTCGCAGAGCTTTGGTGTGCAGACGTTCGCTATTTGGGTT
ATTGCTATCGTGTGGCTGGTGTCTCCATACATTTTCAACACGGACGGACTTGACTGGGAGAAGACCAAGGCCGATGTGACGGCCTGGGCCAAGTGGATGT
ACGCCGCTGAGGACTACAAGGACGAGGACAAGGTCATGGTCGGTGGATGGATCGCGTGGTGGAAGGGCGAGCTCAGCTTGTACCATAACACGAAGCCCGT
CGCCCGATTCACGGTCATTCTGCGTGAAGCTCGCCACTTCCTGCTCATGTGGTACGTGGTGGCGCTCGAGTGGGAAATCCTCTCGGTTGGCCTGGTGTTC
GGTGCTGCTGTGGTCACGGTGCTCGCTATGGGCCTCTTCGGTGCCGCGGGCAGCTGCTTCCGCAACGTGAACTCATCGATCCGTGCTGTCATGTACCTGT
TCGTGGTACTGGTGGCCCTTATTGTGTTCTTTGTGGCCACTATCGTGATCTCGGACGTCAGCTTCACCCGTACCCTCTCGCTGTTCTTCGGCTACATGGC
GGCTCTGTACGGCATCAACGAGATGGCTCGCATGTACAGCTTTGCCAACTCGTCGATCGCGTCCGTGGGCATGTTCCAGCAGCTGGCCTTCTTCTTCGAC
TTCATCTTCTCGGTGGCTATGATCGTGCCGCTCCTCGTGATGTCTGCGATCCCGTTCCTGAACATTATTCAGACGCGTATGATGTACAACAAGGGCTTCT
CGGAAGTCGTGTCGGCCTCGTCTCAGTACGCCTTCTCGCTCGCGGCCTTCATGGGCATGTTGGGCGGTATTGGCTGCGGCTGGCTGTTCCACCTCTTCAC
TACGATTGAGAGCACTGCTGGCTTCCTGAGTTACGTCACGACCTACGACCTGCTCGACGGCAAGGTCGGCGACGGCGCGGTTACCTACGCGTTCTACTTC
GCCTGCATCGTGGGCGTGTTCGTGTCTGGCTTCCTGAGCTACTTCATCGGCCGTCGTCTTTCTATCGTCTTCGGTGGCCTGCTGACTGTCCTGGGTATGC
TCGGCGTGAGTGCTGTCCAGAGCGGCGGTGAAGGCTTCCTGATGCCTGGTATTTGTCTGCTCGGTGGCTCTGTCGGTGTGCTTCTGCCTACGCTGGCCGT
GTACATCTACGAGATCTCCACTCGTGACATGCGCGGCAAGGCCCTGCTGCTTCTTGGCAGTGGCTTCATTCTTGGCGTCCTGTTCGCCTCGTGGTTCTCT
TCGTCGTCGAACGAGGTTGGCTGGGTGTGGCAGGTGTTCATCGCGACCATCATCCTGTCGATCATGACTCCGGCGGTGTACATCTTCCCGGAGAGCCCGT
ACTGGGTGTACATGCGCGAGGGTCTGGAATCGTGCGAGCGTTGTCTGGCTGTGCTGCGTCGAAAGGAGGGCGTGTCGGAGGAGCTGCGCATGATCCGCGA
CGAAGAGGCTGGCAGTGACGACTCGAGCGCCAACGGCGGCACTTCGTTCCTCAAGTTCGTGATGGGTCTGTTCCTGATGCTGGTCTCGGGTATCTTCCTG
GGCTGCGTCAACATGTACCTGTCGGACACGTTCCGCAGCATCGAGGACGCGACCTACATGTTCGTGAACTGCACGGGTCTGCAGTTCCTGGGCGCGCTCT
TCTCGTTCTTCTTCATGGACCGCATCGACCACAAGCGCATCCTGTTCTGCACGCTGCTGCCGATGGCCGGTCTGGTGTTCGTGCTCGGCCTGAACAACAA
GTCGGAGTTCGTGACGGGCGACAGCGAATACCTGATGCTGCAGATCGTGGGTCTGCTGCTCTACTTCTTCGCCGGCCTGGGCATCACGTCGGTGCCCTGG
GTGTCGTGCGTCGGTCTGTTCACCACTAAGCAGCGCGCGGTGTACGTGACCGTCTACTTCATGGTCTTCTTCCTGCTGCCCGTGTGCTCGACGTACATCC
GCTCGAACGACTCGATGAGCGGCGACGAGTACTTCTACCTCTTCGCCCTGACCGGCTGCTGCGTGGTGGCGATGGGCCTGCTGTTCACAGTGGGCACGCT
TAAGAACGGCATGGTGTGCACCAAGGGCGAGATGGAGGCGGAGCGCGCGCGCCTGCGCCGCATCCGCGCGTCTCGGCGCAGCGCCCGCACGCCTGGCAGC
GCGCGCTCAAGAAACTTCAGCCGCTCGCGCGCCAAGTCGCACTCGAACTATCAGATGTACGAGTCGCCCGCTGGCAGCGCACCGTAGAGCGGCTAGGCCG
TGGCAAGATGACGGATTGTACTCTAGTCGAGCAGGAGCGCGCTCGCTGGCTGGCAAGACAGGCACGCAGGCGTCTCTTGTTTTACTTTGCATCTTGCCTT
CTTCATGATATCGTTAATACGAGAAAAAGTTTTACATACACAACCTCTTACGCATACCTAGACCCTTGAAGGAGTTGTAGACATCAAGGTCATAAGACTT
TGAACACTTGGTCGTCTCCACGTCCAAGAAGCCACGTCGGATGTGCTTTCGTATCCACGCAAAGCGTGCGGTCGTTCGATGTCTTCAACTAACCGACGGG
GGACCATTTCAACGTAGCGCAAGGAAGTCTCTTCAACCTCCACTTGAGTTCGGTAGTGAGCAGCAAAGTAAGAGATTCAACATGGTTCCTCCTGCACTCG
TTCAAAACTTACATGCTTTCCATTTCGGCACTAATTTATCCGTGCTCCCTCTTTTGTCTTGACTGCCGCGAGCTTGCTTTCTGCGCTGTTAAATTATGTA
CTGTCGACCAACAACTAAACCTCCCACACAAGGCGGGAAATGACGACGAAACCAGAAGACGGCCAGCAACCCCAACACCACGGGGGCTGCCTGTACAGTC
AGTCATCTCTGGGAGTCCTCCCACTTCCAACCGGTGGTCTTGGGCTCTCGACGTTCCGTCCGTCTACACCTCGACGTGTGTCTTGCTTGCACTCGTAGCC
TTCATGCAGCTACGGCGTTCGTGGCGGTGGGTCACGAATCTGCGCCCACCACTGACACACTTGAGCGCATTGAGGTCTCTCGCCCACCTGTCGACGTCCT
GTGTGCGCCCTTGTTCACACGCTGCACCTTCCTCGGTAAGTCACAGGTATCCGAGCGTTTGCGTTTGCACGTACTCGGTCTGTTTGTGGGGTCCTGTAAG
CCTCCCTCAGAGGCACAGCATAGGATTCAATCGCTGTTGGCCAGCTCTGTCCTTCGCAGCTCCTCGCGCACACGCACGGCGTCCGTCTCAATGTCGGTCG
GCTCCTCCATTCCTGCGGCGTCGTTCAGCGGGTCCGGGATGATTTCTGGCGGCTGGCCACAGAAGTGAACGCGCTTGGGCTCTCCCTGCTGTTCGTCTGC
CGGGTCGTCCAGGTACACGCTGAGGTCTGCTGTGCTGCCGCTCTGGTCCGACGAACCAGAAGCCTGTGAGTTCCCTGACTGTCCACGCGAGCGCTTCCTG
ACGGGGCCGATGCCCACGAGTCCAATGAGCTGAACGCCATCGGCACTGCCTCTTCGGTCGCACTCGGGAGGCAGCATGAGCGCGTCCTGGTCCGGAGCCT
GCGGCTGAAGGTGAAGCTCCGGAACGTTCCCCACGGGAGCCATCGGGAACATCGGGGGCAGGCTCCTCCGGGAAGGTGAAAGCTCCAATCTGTGCGTGAT
CTGCGAGTTGAGCATCGTGTTCTGCTGTAGACGCAATTCATCCGCCGGCAGCCCCACGCGGTTGCTGATAATCTCCGCAATCTGCTCGCGCGAGTCGAAT
GACTGTACCAATGGCAAATGCAACAGCAACGTTATTAAACTCACCCGACCACTTTAGCACCGACACAATCCTGTCAACTCACCTTGAACGTGTATGTGCG
TGAGGAGCCCCCAAACTTGAGCACTGATCCGTGCACCACCAGGGTCGGCTGCAGCGCGGTGAGCCTCAAACCATCCACGAACGTTCCGTGAGCCGATCCA
AGGTCCACCAGGTACGTGGCTCCCTTTTCATGATGCACGATCGTAGCATGCAGCCTTGAGATGGAGCAATGGCTCAATACAATATCACAAACCGCAGCGT
TGCGGCCAATGAGGTAAAACGCCTTCTGGTCCACAGTGTGCTGCAAAAAAACAATAAATAATAACATTAGGTCTGATATCCCATGCAACACTTGCAATTA
TCCCCCAACTTCACGCACCGTGGCAATGAGCACGTGCTCCTTGTACACGTCCAGGAGTGAAATCGACCTCGGGGGCTTATGCATGCACCTAAAATTTAGC
AGCACATTGCGACAAGTTAAGGTGAGAAATTAACTTTTCCGTTCAGCAGCCACAAGGGGATAACAGGGGGGGGGGGAATTGCGCAGCCGTACCATGTCGG
CGGCGGGAACGGCACCGTGGGCGGGTCGATGGGGTCCAGGAACTTGGGCTGCACCGCGAACGTGGGCAGGTGGAGTCTCGGCAGCTGCAGCGCCTGCTCC
ATTGTCTCTGAGTCTGCTGCCTGTTGCCTGGAAGCTGGAGCGAACGAAAGTCCGTCCGTCCTCGATCGAAGCGTGTCTTGCGTCGCTAGGAGAATCGCCC
AGTGGCTGGAGCGGGCGGGGGGAAACGGAAACCGAGAGCGAGCGGTCTCTCCACGACGACGCGACGTTCGTTCGTTGCCTGCCTGCCTTCTCTCTCTCTC
GTGCGAGTCGCGCGCAACAAGCGGACGAGCGTCTAGCTTGGGAGTCTGGAGTTGCTGCTGTTGTGAGTCCCTCAGTGCAGGCTGGCACCACGACCGGACA
CTGCGGTGGCCCGGCTCTGCGCCGGGCAGAGGGGGCAACGACGTGACGTAATTGGTCCAAACGCATCGAGTCAGACCAACGTCCCCCCCTGAACTCTATG
CGGTTCAGGAGGTCTTCCCGCGATGGAGCTGCTATTTTCAGCGCCAGGAGACAGCCATGCCGGAAGAGAGGTTGAACGTTTCGGCCAATAGCAGACGCGC
CTTTTCCCGCCAATCGTCGTCGGAAGGCTGAAGCTGCGGATCACGAGGAGCTCCGCAACGGAAGTGTACGTGTACGTGTGCGTCTACGAGTCGCCCGCCC
CATGGAGGAGTACGTTGCTGTCGTCGTTGCGCGGTTGTTGCCGCCGCCGTCGCGCGGTCGCGGATGAGTGGAAGGGTCTGATCGTTTCGCTGCGTGTCTT
GTAGGACGCACGCCGCGCGCCAGCGGCAGGACGAGCAGGTGAAGGCGCGTATCAGCGAGTGGCTGGTGCAGAGCGGCGAGAAGGAGCGGCTCAAGCAGCT
GCTGCGCCTCAAGCTGGTCGAGTGCGGCTGGCGCGATGAGATGAAGCTGCACTGCAAAGGTGCTGCTTGGAGTGTACTGTAGTAATTGGATTGCTACCTT
GTTGGGGTGGGGTGGACTGTGAGTGAGCTGAGACCGTGGCGATTGACTGATTGCCAACCCGTAGAGGTGATCCGGAATAAGGGCATCGACCAAGTGACCG
TGGAGGATCTGATCGAGGAGATTACTCCGAAAGGAAGAGGTGAAATGGAGGCTGTGTACTCTGGTGTTGAGCGGAGGATAGGACGGCGTGGCTTAATGGC
CGTGGTGTTGGTTGCGTTGCATTGCATTGCTAGCGTCGGTGCCTGAGGACGTAAAGAACGACCTGCTGGAGAAGATCAAGGCGTTCATCGAGAAGGAGGC
GGGCGACGTCAAGTTGGACGCCAGCACGTGAAGCGAAGCGGATGCCAAGCAGTTTGAAGCCATAGAGCAGACACGAACTAAATTCGCAGCCGCCGGCACT
CACGCGCGCTGCGGATGGCTGCCAAGGCGGCGCGCGATACAGCAGGCAGGAAAATCCAGCGGAGACCCATTGACAACTAGCGTACCACATGGGATTGCTG
TCTGCTTGCCGCCGCTGTGGACGCTTTCTTTCGCGCTCACGTGGACGTCTAATCCCGAAAGTTACAAAATCCAAATTGAATATTTGCGGTTACAATTTAA
TTATTTGCTTTAGTAGTGACGGATGTCACTAATCCGAAACGGCATCGTGCGGCCCGAAGCCACTCACTTCGCAGAGCAGAGCTCGGACGATCATGGTGGT
GAGACTGCGCCTGGCCCGCTGGGGCCGCAAGGACCTGCCCTTCTACCGCATCGTGGCCGCGGACGCGCGCGCCCCGCGCGACGGCAAGCACCTCGAGATC
GTACGTGTGTTGCCGTAGCCAATTTCCCGTAACCGCTGGTTAGCACTAGCCTAAACGCCTCTAACCTCTTGCAACTTTTTGCCATTTGTTGCAGCTCGGC
ACGTTCAACCCCATCGCCGCCAGCGACGGCGTCAAGGAGCTGCGTGTGAACAGCCAGCGCGTGCGCTACTGGATGTCGGTGGGCGCGCAGCCCTCGGACC
GCGTGGCGCACCTCCTGGGCCTGGCCAACGTGCTGCCCATGCCGCCCACCCGCCAGTACATCAAGAAGAGCGTGCCCAAGAAGGACCGCGAGTAGACAGA
ACGCCGAGGAGCAAATGGCAGAGAGGGAGATGGGCAGCAGTAGATGGCTACACGGAGAGATACATGTATTTTCACATAAAGTCTCTTTGTGTCTAACCTT
GTATTTGCATTTGCAGCTTCTCAGTGTTATGGTGTTGGTGACAGGAGATCTTGTCGTGGTCGCAGCAATACGAGAAGTTGAGGGGCAGTTCTCATGCAGC
AGTTGAAGGCAATCCACTTTCTCCATCTGAGGGTAGTGGAGCAATTGTTGTGGCTCGCCCACCTGCAAGCCTTGGCGGGATTGATACCCGGTGTGCACTT
GCCATGGGTCGATCGTACAAATGAAGCTCGTGGCACTCACTACTCTTCGCGCTCTAGAATCGTTTGGTCGAGCCTTGGACATTTCAATCGGAAGAAATGG
CACAACGATCAAGTTGAGGCTCTCAAGGAGATCATGGTGCTCTTCGAGCAGTAGCGTGCACCCCCGCCGGTATTATAATATGGCTCGAGTCCAATACGCT
TTCAGCGCCCGCGCGCAACGGGCTCATTCACGGCTCAAGTTCGTCCGATATTCACGTAATGAACGAGGATAACCCGAGTCAAACGGTATTTGTTTTCAAG
TTATCTTACGCAGACGAAGCCAGCTGCAGCAGCGAAAGGTAAGAAGCTCACGCCTGGACGTTATGCAGCTCCACGTGCATCCTGAGCGCGAGGTCTCTCT
GGGCTCGGTTCTCCTTGAGGCTCAGCCACAAGTTGAACAGGATCGCGAGCTCCTCCTTCTCGAGCGGGCTGTTGAGATTTCCCCTCGAGTAGAGGTGCAG
GAGTCGGGCCTGGACGATCGCGAAGCATTGGTCGGCGGTAGGCTTGAGCCTCGGTTGCTGGGGAGGCTGAGTCGGACCTGGAGCAGCCATGGGCTGCTGC
GGAGAGACCGGCACTGCCTCCGCTTGCTCCATCTTCTGCGGCGTAGCCTGCTGTCCCTTGGCCATGGCGTCTGCGCCCTCCACGGCAAATTCGATAGTGA
GGCATGAGTGCCGCCGCGAGTAGCGTCGTCAAGCAGCTACAGAATGGATACACCTAATGTTGAAGTTGAAGTGACAAGTTAATGACAAAAGGCAACTTCT
ATTGGAGTGGGGTAGTAGCGGAAAACTAATGCAATAGCTGGTAGAGCGTGGTAAAGCGAGCCTACTTCCGGGGCGTGCGCGCCCGCGGCGCCGGCCCGCG
CGCGGAGCCTCCGCCCTTGAGCATGTTGCCGCCCTTGCGCACTTGCTGGTTGAACGTGGCGTTCTGCTCCTCGAGCCAGCGGCGGATCTCCTTCTGCTTC
TCCTCCTTGGCCGCGAGGCGCGCCTCCTCCTCCTTCTGCTTCTCGCGGTGGATGAACTCGGCGTCGCGACGCAGCTCGCGGGCCGCGCCCTTGCGCGCGC
GCTTGACTTGGCGCTGCAGCTGCTTGAGCTGCGCAGTGTCCTTGGGCGCCGTCTTGTCCTTGCGGACCGTGTAGTTCTCGTCGAAGAGCGGCGCGAACGT
TGGCAGCGTCGTCGGCGCGAAGCTCTGCAGACGTAGCGGACGACGCGCGTTCCAGCACGAGTCGAGACGCTTGTGCAGCTTGGAGATGACGGCGTTCACC
TCCGAGATCTTGATGTCCTCCAGCTGAGTCACCAGCGCGTGCAGCAGCAGGTACTGAGGGTAGAACAGCTCATCGAACGACGGCAGCGACGCGTACTGCG
CCGACGTGGCGTCCAGCAGAGCCAGCAGCGAGCTCAACACTTGAGCGCCGCTGCAAGACGAGCTGCCAGCCAGCGACAGACGCGGCAGAGCGGGCATCTT
CTTCTCCTCAGAGTGTGCAGCCACCCATTCGAGCAAATCACGACGCAGCCAGTGGACCGAGGACTCGCTGTCGTCTTCGTCGTCGGCTTCCTTCGTCTCA
CTAGCACCCGACGTCACGAACGCGCGGAGGATGCGAGTGAGGAAGGTCACGACCTCCGGCATAAAGCGCTCCTTCGACCGCGTCATGTCCAGTGACAGCG
AGGCAGCGAACAGCGCCTGAGTGGCCTCCTGCGGGGAGCTCACAGCACCGCGAGCCAGACTCTCGCCCAGAAGCGTCTCCATGGGAGACACCACGTTGTG
CCGCAAGTCGGAGGTCGGGAAGATGGACGTAAGCACCTTAAAAAGAAGCAGCTCCGGTAGCGACGGCCACGCCGAGGTCGAAGCGCGCTTGCGCAACCGC
TTGAAGAGCTGAGCAAGCAGCTCACGCACCACGACACCGGCAGTGTCACCCATCTGCTGCGCCAGCGTGTACATGTTCCTCGCCAGCGAGTCGAGCTGTA
ACAAGCAGTGTAAAAAGTTAGCATCAAGACATGCATAAAGCTGCTGGCAAGAGTAAAACAACGTACGTCTTCCTTGTGTGCTGCGTAGCGCGCCGCGAAG
ATAAGGAACTGGCGCACCATCACCGCGAAGAAGCGCTTCATCTTGTTCTTGTTCTCAACGCTCAGGCGCGGGTTGTAGTACGTGACAATGCGGTCCAAGA
TGAGTCCGCGCTTCTCGGGCGAGTTGCGCGCGTGCTCCTTGAAGAGCGCCGCGAGCTCCTCAGGGGACTCCGGGCACTCGAACACGAAGGGCAGCTCGGC
GGCAGCATCCTCAGCATCCTGCTTCCGCTTCTGCTTCTCAGTCTCCTCGTCGCTCTCTTCTTCGTCCTCCTCCTCTTCGTCTTCCTTCTCTTCCTTGTCC
TTCTTCTCCTCAACCTCGTCTTCGTCGTCCGAATCCGCTTCCGAGTCGGCCTCCGAGTCCTCCTCCTCGCTCTCCTCCTGTTCCTCCTCATCCTCGTCAC
CCTCCTCAGCATCCACGTCGGCCTCTTCCTCCTCCGCGTCAGCATTGAAGCGCGAGTCCACAGCATAGCCGTCCGTCAGGTCGTCATCCGTTGGCGGCAT
GATGATAAGCTTGGGTCCCTTGTCCTTCTTCCCCTTCTTGCCCTTCTTGCCCTTGCGCTTGCCCTCGTCCTCACTGTCGCTGTCATCGTCGTCAGCGCCG
TGCATACGCGCCACACGCTTCTTCTCCAGGGCCGCAAGACGGTCGCGCTCCTTGGCCGCAGCCTCCTCGGGCGACATCCTGCGCTCCGTGGCCTTGGCCT
TGGCTTCGAAGGCGAACTCCCTCGTCAGCTTGTCGAAGTCGTCCATCGGCTCCTTCGGCAGCAGCTCCTTGCCGTTGGCGCGCGTGGGCCGGAACTCGAG
CAGTCCGCGCAGGTCGGCGAAGCCCTCGTCGAGCTTGTCCGTCTCGTCCTCCTGCGCCGTCTTGTTCTTCTGGCGCTCGGCCTTGAACATCTTGGCCTTC
ATCATGACCTCCTGCATGACCTCCTTGTGGGTCTTCCTCTTGCCGTCCTCTGCCTCCGGCGCGGAGGCGTCGGCGTCGCCCTTGCCGCCGCCGAAGTGCA
GCTTGTTGACGATGTCCCTGTCCATCTTCCTGCTCTCCTCCGAGTCGTCCTCCTCGTCCAGCGGTCCGTCCGCGTTCAGGCGGTCGTAGTCGTCGTCCGT
GATCTTGGCGCCTTTGTGCGTCAGGAACAGCGCGTCGTCGTCGCCCTCCTGCTCCGAGTCCGAGTCGTGCAGCGCGAAGGCCGCGGCGTTGCGCAGCTTG
CGCTTGCGCTCCGTTTGGAAGCGCGCCATCATCTTGTCCTCCATGGACAGCGTCGGGTCCTGCTCGCCGAGCCGCCGGTCCTTGAACACGTTGCTCTTGT
TGCGCGCCTTGAACTCGGCGCCCAGCGTCTTGCGGCGCTTGCGCTCGGCCTCGGCGCGCGCGGCCGCCACGTTGCGGCCCGCGCCCTTGACGCGCCGGCC
CAGCACCTCGTGCTTCTGCTTGCTGGCGTTGCCGCGCACGTCGAACGGGTTGGCGCCGCGCGAGCTGCTGGCGCGCACGAAGCCGTGCTTCTGCTTCTTG
GCACCACCGCCCGCGGCCGCCTTCTTGCCGCCGCCCTTCTTCTTGAACGCCATGGTGGGAGGAGGAGATGCAGAGACGCACAGACACTACTAGCAATGGG
CCCTGCAGGTCGAAGTGCTGGTTGAGTGATGTGGTGGCCAACCGTTGTGCGACTCACAGGGATAGGGATATCTAACTAAGGGTGGATAGTTTTCGGTGGA
AACTTAGTGGTGTAAATCGGCCGAGTGTCGAGTTTTCGCGATACGTAGTGGTGTAATTCGTGACACCTTACCTTCGTTTTCTTAGCGGTGCAGGGACTAC
AGAGCTCCGCGATTAGAAGCGAAGCGCTGTAGGACACCGCTGAGCTGCTCGGTGGACAACCTCTCGCCTTCCCATGTTACACAGGCACACCCTTGCTCGC
CGGCGACGGTCCTTGCTCTCCGTTGAACGTGTGTCAACGGCAAGAGTGAAACCGATGCATGGCGGTTGAAATCTTCGCTATCCGAATCCCGATCCCATCA
ACGCCCCACACGAGCAAAGGTGTCATGTAGCGAGGGTATGCCCAAGATGTTGGCGTCCGTTCTCCCATAACCAGCTCATCACACTACAGTAACTCGCCCG
TCCAGCGTCCATGGTCAAGCTCACGGTCACTATCGCCGCGGCGGTGGCTGCGGCTGCAGTTATCGTCGAAGGGTCCTCCGACCCGTGATCTCCGCTCAGC
CCTCACTCGCAATTTTTGCGCGACGGGAGATCGACCAGTAGTGGCACGGGACTTGGTCCTTCAGACAGCGACGCCGACGAACCTCCCCCGAACGATTTTA
GCCGCGACTTGGAGCAACCCGAGCGTGGCGGCATGTTTCGCGGTGGGCAGCACCATCGCTTGCCCCCGGTTGCAGGACGTGCCGACTTTTCTCTCAATGC
GAGCGACGAAGGAGGTAGACCATGGCACGGTAGCGGAAGTTTTGATGGTCGTTTCGACAATCCTCCACCGCATGCCGGGGACGGTGAAATGCCACCCTTT
TCGAACCATGGGCCATTTCGTAAGGACCACCCGAAGCACTTTGACGACAAGAAACCCAGCAATCGCAATCCTCTTCCTCCTCCACCTTCTGCTGACGGCA
AAAGGTTTCGTGATCATGCCACCAATTTGCTACGGACAAGGGAAAAGGTGGAGTGCCATCTCAGCAGTGGGTTTGGTTCATGGCCTGGTAGTGCAAGTGA
TGCCGGAGGCGTTCCACCACCGTCAGACGTAGGCGACGTCTTCGCCCCTCCGTTCCCCTGGCAGGATTGTGCTCCCATCAACTTCCGGCGCCTCCTAAGC
AAGGTAACGGCGAGGCTTCAAAGCTCCAAATTCCTAAAGGAAAGCAGCCTCCATTTCCTGCCAAGGGTGTCATGTCTGGTGGGGACAGCCATTTTTCGGA
CGACTGCCGCCCAGCCCGGATGGGTTCCGTCCTCCTCCTCCACATCTAGGCAGCAACGGAAAACCTACCACCCGAAGCACTTTGACGACAAGAAACCCAG
CAATCGCAATCCTCTTCCTCCTCCACCTTCTGCTGACGGCAAAAGGTTTCGTGATCATGCCACCAATTTGCTACGGACAAGGGAAAAGGTGGAGTGCCAT
CTCAGCAGTGGGTTTGGTTCATGGCCTGGTAGTGCAAGTGATGCCGGAGGCGTTCCACCACCGTCAGACGTAGGCGACGTCTTCGCCCCTCCGTTCCCCT
GGCAGGATTGTGCTCCCATCAACTTCCGGCGCCTCCTAAGCAAGGTAACGGCGAGGCTTCAAAGCTCCAAATTCCTAAAGGAAAGCAGCCTCCATTTCCT
GCCAAGGGTGTCATGTCTGGTGGGGACAGCCATTTTTCGGACGACTGCCGCCCAGCCCGGATGGGTTCCGTCCTCCTCCTCCACATCTAGGCAGCAACGG
AAAACCTACCGCCGTCAACCACGAGTACGACCCCAACGCTGAAGACACCGTGTCTTAGACACGCAGTGTCTACTAGTGATTGTTCAGGCTAGGCGAGGCC
GCACCGTACATGTCGAATCATGCCGTGAAAGCCATTTCGCGACCGTGACCAAGATCTTCACGAACTAACCTTTTCGTCTTTGTCGATACTAACATTTTTC
AAGCCGTAGCAAAGTAACATTCGTACGGAAAAATCGTATATTGTTAGGTCGTCGCAAGTGATACAATGGCTATCCCCATAGAGTGAGCAGAAATACTCGG
TAGCTGTGCTACCAGCAACCCCGCGACGCTGCCAATGAAAAGTGCCGCCCTACCGAAGCACCTTGTACACGTACTCGTCAAAAACAGGATGGAACTTACA
CAAGCCCTCCTCGTGAAACTTGGGGGTGTCATACAACCAACAGCAGTGCGGAACCCCGGGGACCGGGTAGCGGAACAACGCTCCCCTTTCATCCAGCGTG
CGCAAGCCGTACGTGTCGTCCTTGTACTCGACTGTATCACGCATCTCTACGATCGTGAGGCTCTCGAACCTAGTCTCAAGTTCTTCCAGTGTCTCAACCT
CGCTGTAGTGTTCAAGCAGACCCATTTGCCATGGTGACGCCGCGCCATCGTCCGGAGAAGCGAAGAAATGCGCCTCCTTCAGTCTCAGAAAGTTGTTTTT
GCGGCGAATCTTCTCCAAGTGGCAGTGGAAATCAAACCACGCGCAAATATTCACGTTGTTGATCATGGGTAGGAACTCGTTAGTCGCCAGCCAGACGTCA
CGCACTGGAATTCGTCCTAAGTTCGTGTAGGAGTAGGTGGCCTGGAGCTTGGGGTCCATACATCGACGTGCAAAGTCGGCTTGCATCTTCCCTCTGTAGC
CCTCGGGTGTGTACCCCGTAAAGTCAAACAGATTTTGCGGCAGGACGGCTGCGCCAAAGCCCGCTCCTAAGTCGTGGATCGAGTTGCGGTCGGCCTCTTG
AGGGCCGTAGAAAATGCCGTTCACTCCTCCTGCCAGGCTCACGTACGTGTGCACCTTGTGGTCGTCCATCTGCTCGATCACCGCGCGAGCTATCATCGCT
CCTTGGGAACGCCCGATGAAGATGTAGATATCGGCGAAGCGTTGATCGCTTGCCACCACCTCGTGCACCGCAGCGATAACCATCGGCACTTGGGTGTTCA
ACGCCGTCAGAGAGCACTCCCTCTCACAGAAAGCCAAGGGAACACGCGCCCTTCAGCCGTCAAGTTCGCTTGCAAGTTGGAACCTTCCCCGCTGTTGCCC
GTGAGCCCGTGGAAGAAGAAGACCGGGAGATCCTTCTTCTCGGAGACGTCGGAGCCGGTGGCAGGTGCATTAGCGTTGAGGTTCGCCGCCACAGACCGGA
TGGAGGACTCGTCGAGACAGACATCGTTCCCAGGCGGAGAGAGGTCGATGGCTGGCGACGCCGTCGCCAATAGAGGGAGCAACAGCAACTGTAGCAGCAC
ACTCATCTTAACGGTTGACTTGTGCTTGAAGCGGAGACTTGGTAAATGATGAGTGAACGAGGTCGAGCTCCTGATGAGAGACCAAGCAGATACTTAAATG
AAAGTAGATACGCGGGCCATGTGCGACCGCGTCAAACATGCTTACGAACCAATTAGATATCAAAGGCAAACATGAGCCCTGGGGCTTAACAACCCCTATG
GTTCATGCATTCGGGGGCAGGTTGGGGCAACTCTAAGCGGGAGTTTTACGGTTATTGAAAACATTATTAAAATAGTGGTAAGGACTTATTGGGATAAGAA
GCGGCGTTAGTGCTGGAATCACAGCCCTTGCCATCGAACAACATTCGCGCTATATTCGTTGCTACCACCAGCGGATAACACTGCGTGACACTCACGTTAT
AGCCGGTCCTCTACTTTAAAATAGCTGGGATTAGCTGGGAATCTTTTGTTTTGTAGTGTAGTACTCGTTAAGGCTGGATTTCAGTAGTATGTTGTTTTAC
TTTGACCAACGGATTCGCACTTCCTCTCAAGTGTGACGGTGCCAGTGGGACCGAAGATAAGTAACCATCAGCTAGTCTCGTTCATGTAGGTCACAGAATC
GATGCTACAAATTCGGGCGTCTGCGTCTGGAATCCCTGTCTGATTTCCAGAGATGATCATTTTTTTGATTCCGTAAGCGAAGTGGAATCGGAGTCGGACG
CTTGTGACATATCTCACCGGTTTACTAGTATCTGTAATATGTATTTCGAAACTCCAAATGGTTCGTAAGCTTCACTAAATGATGATTACGAACGTTTGAC
GCGGTCTCACGTACATATATTTTCGGTCTTGTTTACTTACAGTGATACACTCCTTCTGCAATAAGGAACGGGCAGTCTGTATTTCCGTTATTTAGAGGCA
CGTCTGGTTGAGGGTAGCAGGTTTCCAAGTTCTGCGCGTTGAGCTCCTCGCCGACCCGTAGATGCTAAGTCGCGTCAGCAGGCGTCAAGGTCGGCCGCAC
CTCCCCGACCGTCTTGATGACACTCTCACAGTTGTAGGCTACAACTTGTAGCCGCAGCCGTGACCAGCACGACCTTGTAGGCGTCACCGAAATGACGACT
TCGGGCACCTGGACGTAGGGTGCGTGCATCCTGCGGCTCTTAATGAAATGTGCGTACGCCAAATTGTAGTCGTTGAACTTGTCCGAGACGTAACCTTAGG
TCTGACTGAACGTCGAGTTCTTGCAGCCGAAAGTATCAACCGGAATCGGAAAAACCCAATATCCGTAAAAAAATGAATTTGCAGTGACTTACGGAAATAA
CTACTGATACCCGTCGTAAGTTGTATATATTTTTGCGTCAGACTTCCAATTCGTATTGCACGAAGTTGGTGCTTGATCTAACCGAGGAATCAGGAGCAGG
GACTGACAAAAAACCGGTGACTTTCACTATGAATATCTGACTGAAATCGGGCTCAATTGAAACGGAACGTGTCTTGCTTTATCCAACCTTTGTAATACTA
TCATCTAAATTACAAGTGCACGGAATCTAATGTATGTACTGGTAATGGTAGGGTACGTAATGGGTAGCCGAGGTAAACTAACCATTAGATTTGTTCTACT
ACCACACAGAATGACCTCGAAGATGACGCACGCAATGCTGCCGCCGTACGTTAGTATGACTTTCAGTTCGCTTTGGCTGTGGATTCTCTAGCGTAACATT
ACACGACAATGTCAAGCCCACTCAGCCGTCCGAATCTCGTGCGGGGAGCACTCTAGAAGGTCGAGCTGAAAGACATGCATACTTGTGTATTGGCCCAATA
TATTTGAGATTTATGGAACTTTAGTAAAAATGTTGTACTTTTCTAGAAAAAGCTGACAGCTTGTTTGTGCGGTAGACACGTTCCAAATTTACTTGAAGTT
TGTAAAGTTTGTGAGGCATAAAACAATCTTCGAGCAATTGAAGTCGGAACGAGCACCCATGCCCCAGGAAGTGTCCCGCTTGCTCGTCGTGGAGCTGCTT
TTCCGTGCCAAGAGCGCCTTCGTCGACCTGTCACACGTCATCACCTCCGTCTCGCAGTTCCTGGACTCGTCGGTCGAGTTGCCGCTGCACAAGGCCTGCG
CCTTCGAGTCTCTGCGACTGCTGGAGCGCATCCGGGTCTCCACTCAAGCCTATCGCAAGCAAAAACGCGGCGGCAACGACTGGTCTCTTCGCAAACTCCT
CCTATCCGACCGCTTCTACCGCCACTACCAGTTCAACCAGTCGCTGCAGGAGGTAGTGAAGCGTAAAGACTTCAACTTGGTCAAGTGGCTGTCCGCCCAT
TTCCAGGGCGTTGCCATCGTGCCCCAAGTGGCGACCACAGCCGCCAGTGTCGGGGCCATGGAAATCTTGCAGTTTTTCCTTGATAACGACAATTCTTCGC
ATAGGAGGCAGCTACAATCGACAAACCCCACCAAACAAATTGTCGTGGGGCATCGAGTTCAATGGAGCAAGGACGCCCTAGAGGTGGCGGTGCTACACGG
CCATAACAACGTCATGTGGTGGCTATTGCAACACACCCCAAGCGTGAGATACGATAAGAGCAAGGCTTTTGAGTACGCTGTGAAGAACGGGGACATCGCC
CTGGCAGAGTGGCTACTGTCTCATGGTGCCGCCTTGCGGCTGCAGATCCAAGGGCGCCGTTTAGTGCACGAGGTTGCAGCTCAAGGCCGCCTTGATGTGC
TCAGGTGGCTGGAGAAGGAGGAACTGGTTTCGATTAGTTGCGGAGTGGTAATGGTGGCAGCGGAGAATGGACACTTGGATGTGGTGCGCTGGCTGCTGGA
TCTGAATGCCGGAAGAAGTGACAAACTGGGGGGAGAGGCCAGTCTGGCAATTCACACCGCGGCGGTGAACGGGCTTCTTGACCTCGCCAAGTACCTTCGA
GCGCGCGCGGAAACACCTCGAAATGCTTGCCAGTGTGCGGTGGAAAGTGAGGAGCAGGATGCTCTGATTCGAACTTTGACTACGCAGCGTGGTGAATCGT
GCACGGCTGCCAAGGTCTCGATCGATACGTTGATCAAAGCCGGGAAGAATGGCCATGCTGGTGTCGTGAAATGGCTATCAACGGAGTATTGTTCTGTTAT
CGCCGACGGATATCAGCAGACACCGACCGATGGAGCTCTGATGGATGGTATCGCTGCGCGAGGGCATCTGAACGTGTTAGTTCTGGTGCAGGCGATGGAA
T