Description :
From Genome Similarity Track
Location :
Scaffold_557:13505- 16648
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_557-snap-gene-0.5P-type ATPase (P-ATPase) Superfamily

Sequence
3143 bases(100 bases per row)
GCTCGNNNNNNNNNNAATGTCGTGATCACGTCCAAGTACACGACGTGGAATTTTTTGCCACTGTTTATGGTCGAGTCATTCCGCAAACTTGCGAACGCGT
ACTTCCTGCTCGTGTCGATCCTGCAGTGCGTTCCAGACATTACCAACACAGGCGGCTTGCCCTCGAACTTGCCCGTGCTCATGTTTATCCTGGCAGGNNN
NNNNNNNGCGTCCTCGCGATCATCGAAGACCGTCGTCGCCATCGCGCAGATAACGAAGCCAACTCAGCAGAGTGCCATATCATTACGGCGACATACACGG
GGACGAGCACGCACCTGAAACCGACGCAGGACCCGGATGTGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGACCTGACTGTCGGCACA
ATCGTGAAGCTTCGCAACCGCGAGACTGCACCTGCGGACTTGGTGATCATGGCCGTGGACGAAGCCGATCCGAGCGATCCAAACGGTATTTGTTACGTCG
AGACCAAGTCCCTGGATGGAGAAACCAATTTGAAGCTCCGTCAAGCGTGCGAGAACACGCTGCATGCGCTCACAGCACAGCAAGTAACTTCCTTGAAAGG
CTACGTGCGCTGTGAAAACCCGAACAAAGTCATTGGACGCTTTGACGGCACGCTCACAATGAGTGCGCAAAGTGCGCGTCCACCGAAACATCAGCAGCAG
CACCATGCGCCACCAACCAGTGGCTTTTCGGACGATTCTGCGACTGTCCAGATGCCACTCTCCATCAAGAACGTGCTCCTTCGTGGTTGCCAGTTGCGTA
ACACCGACTGGATTTATGGTCTGGTAGTCAACACCGGACCAGACACAAAGATCATGCAGAGTTCGGTTGCAGCACGTCCCAAGTGGAGTGCGATCAACGA
AGAAGTGAACAAGATGATCATCTGGCTGTTCCTGTTCCTGTGTGCGCTCTGCGCTGCGGCGGCGACAGCGCATGTCGTGTGGATGTACAACAACCAGACG
GACACAGCGTACCTTGGTGCGAACCGCGGGTATGCCTCGCAATGGTTTATCACTGCTGGCGCGTACTTTTTGCTCATGTATAACATGATCCCGGTGTCGC
TGTACGTCACGATGTCGTCTGTCATGTTCATCCAAGCGATCTTCATGACCTGGGATATCGACATGTACTACGACGAGCTTGATGTGCGCATGATTGTGCG
TTCCATGGGGCTCAACGAAGAACTCGGTCAGATCTCGTACGTGTTTAGTGATAAAACCGGTACGCTGACCTGTAACGTCATGGAATTCCGTAAATGCTCG
ATCAATGGCATTTCGTATGGGACAGGGACAACGGAAATTGGTCGCGCAGCATTGCGCAGAAAGGGGATTGTCGTCCCGGACGAGCCTCTGTCGGGGTCCT
CTGGCACTAGTGCAACGAAGCACTCGGCGAAGGTTCCGTATGTCAACTTTGAAGATGCTCGGTTGATGAGTGCGTTGGAAAGAACTGACCGCAATGGGGG
ATCACCCGAAGCCGATTTCTTCTTGCACCTCAGTCTCTCCCAAACGGTCATCCCCGAAGTGATCGAAGGAAGCAATGAAGTCCGCTTCTCGGCGTCGTCG
CCGGATGAGCAGGCGTTGGTGTCCGGCGCCAAGTTCTTTGGCTTCAGTTTCGAATCGCGTGGTCTAGGTATTGCGCGTGTCCGTTTGCGCAACAAGAGCC
TGATGATCAACAAAGATGCGGAGTCGGAGTTACAAGAGTTCAAGATTCTGGACGTGCTGGAGTTTACCAGTGATCGCAAGCGCATGTCGGTGATTGCTCA
GTACCCAAACGGCGAGCTGTGGGTGCTCACGAAGGGAGCAGATAACATGATCTTCCCACTTCTGTCAAAGTCACAGAATAACCCAGAAGTGATGAAAGAA
ACGATGCGTCATCTCGAGACGTTCGGCGATGACGGCCTGCGAACGCTCACGATCGCGCGTCGTCGCATCGACGAGAAAGAATATGCCGTTTGGAGCAAAC
GTTTCAAAGATGCAAACTCGTCCTTGGACGAAATCGAAAAGCGCAAGAACAACTTGCCAAACCTCATCGACGACTTAATGTGCGAGATTGAAAAAGACCT
GATTCTTTTGGGCGCGACGGCAATCGAAGACAAGCTGCAGAACCATGTACCACGTGCCATATCCAACCTCATGAAAGCTGGTATGAAAGTGTGGATGCTG
ACTGGCGACAAGCAAGAGACGGCGATCAATATTTCCTATGCGTGCCAGCTGATGGATAATGATATGAAGCAAATTGTGTTGAATTGCGACCTATTCCCAA
CGCAGGATGCCGTGCTCGCGCACTTGGTTGAAGCGAATTCGCAGACGGCACGCTCTCGCCAAGCAGTTGTAATCGACGGCGAATGCTTGGAGATGACGCT
GCTGGACGACCGTTGCCGAGAAGAATTTTTGAAGCTGGCGATGAGCTGCGAAGGTGTTGTTTGCTGCCGTGTTTCTCCGAGCCAGAAGGCTGAAGTCGTG
ACGTTGGTGCGCACCACGAACAAGGATGCGCGTACGTTGGCGATCGGCGATGGTGCAAATGATGTTGCGATGATCCAGCGCGCGCATGTTGGCGTGGGTA
TTTGCGGCATGGAAGGTATGCAAGCCGTGAACTCGAGCGACTACGCGATTGGCCAGTTCTATTTCTTGGAGAAGCTGTTGCTGCACCATGGCCGACTGAA
TTACAAGCGTATGTCCGTGCTGGTCGGCTACATGTTTTACAAAAATATCGTGATGGTGCTTGCACAGTACTACTACATGGTGAGCTCGAACGCCTCCGGT
CAGAAGTTCTACAGTGAAATCGCTATCCAGGCATACAACATCGCGTACACGTCGCTTCCGATCATCGTGCTCGGTGTGTTCGACTACGATGTGCCGTGGA
GCGTCGGCCGCCATTTCCCGCAGCTCTACTTGATTGGTCCACGCCGAGAGTTGTTCAATAATTACACGTTCATCAAGTGGATGTGCAGTGCCGTCTTTGA
ATCGCTGGTGATTTTCGTGCTCGTGATGTTTGGGTTTAACGATTGGACGTCGAACGCAGGCAGCGCGCCAATGGTCCAGTACGGGCTGCTCTGCTTCACG
TGCGTGGTCCTCGTGACGAACATGAAGCTGATCATGCTACAGA