Description :
From Genome Similarity Track
Location :
Scaffold_73:13505- 14812
Sequence
1307 bases(100 bases per row)
GATCTTATTATCTTCCTCACCTCTGTGAAAGCCAGTAGGGGTCATTATTACCTTCATTTACACTTGGTAGCACTTGCTTGTCGTCCCAACGCCCGATACT
GAGATTAGTATATCCCGCCGCCCAATACTTCAGCAGTGACTTTGGAACACGCAGCCTTGTTTCACCTTATACGTATATAGTGCAAAGTCCTTCAGGGTTT
CGCGGTTATGTCATGGAGTTTGTCGCTACGTCACTACTCAGTTTAGCGACTTCGGATCTATAACGCTTGCTAAACCATGAGCTTAAGGACCGTGCGCTTG
CCGAATCACATCATCGAGCATAAACTCCCTCCCACCCTTTCCTCCGCAACCCTTCCTGGAACGAGTCCTTGAAGATGAATACGTCCCCCTATTTTGTTAG
ATGGCAAGGACTACTTTTAACCTAATTTTAATTTCAGGGTAATTGATACCGCCATCGACTTGCAGGTAATCGAGTCGCCTAAACAAAACGAAGGCTTTCT
CATATCCCGGCTATCCAAAACGGCCAATGAATGGGATCAAGGCAGACAAACCATCGACGAACTTGCTGTCCTAAATCTAAAAGGTATCCAGAGATATCTC
CGCCTCGCTTTAGAGACCCCTAAAGATCAGCACGCAGCACGCGGAATATCTTAAAGATTAGACAAGTCAAGATGTCTTTGCATGACTACGTGCGAAGGAC
AAGGTGTATGGCTTCGTGTATTTTCACAAAATTCATTGACATGTCATCCGAGACCCGTTTTTTGTTTTTGGAATTCGTGATAATAGATCATTATTTACTT
ATAAGATAAAAGACATCTTCGCTTGGAGGTGCTATTCCTCTCGCTCTTCACGATGGTTCCGGGTTGCATCGCCTTACGCGAAGGTCATGCTCTAGACGCC
CGTTCTTCATGTCCAGAGTCCATAAAAATTGACGCAGTAGAGGCTACAAGACGCCTTGCGACTACTGGTGAAGTGTAACCAAATGATAACAAACTGGCAT
TTTTCCGCTGTACTGATCAAGGTCACAGCGTGGCATAGTGCCACGCGGCAGCTCCTTGTCGTCGCCTAGGTAGCAGTCACCATTTCCAGTGACTATGGCC
AGAATTAGTTATAAAAATGACGAGGAATCGTAGATGCAGGGCTACCTGGGTGAATTTTAGGCCCGGCTTCCTTTGTTGCAGCTCGGTATACTAGCCCCCA
TTTGCTTCAAGCACCTTCTAATGCCACCGCGAGTGGTGGTACGAATGTAAATGTCGTCACGACACATGTCGCTGGTGCCCGGAGACCCTGCAAGCACGCC
TGATCTC