Description :
From Genome Similarity Track
Location :
Scaffold_799:13504- 15365
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_799-fgenesh-gene-0.3FtsJ methyltransferase domain-containing protein

Sequence
1861 bases(100 bases per row)
AATTTCATACATCGGAAGGCGCTCGTGGCGATCTCTTGCCACAAGATACCGCTCCGAACTCGCTGGGCGGCTTGTCTAAAGTATTACAAGCATACAAGCA
AGACAAGACAAGCAAGTGCGCAAGGTAAGAACCACACTCATTTGAGTCTACAAGCTTCGCAAAATGACAGAGAGAGACTTACGATTGGCTTGATAACGGT
GAGCTTCGCAAAGCACTGGTGCAGGAGCCAGACGAGCTGCAGCATCATGGGCGTCGCGAGCTCGAATGTCTTGCAGAGGAAGCTCCCGTGCGCGCGCAAG
ACCGCGAACATTGTGAGCATCTCGGCGACCACGAGCCTCGTCATCACCTGCTCCTGGTTCTGCTGGTCGCGCGCGTCCTGGAAGCCGCCGTCCGCGACCA
CCAGGTGCACACCCTCAGGGTGGTTTCTGCCCACCACTTGGTCGCGAAAATGGTGGATGTTTGCGAGCGCATAGAGGTCACCCGTGCCGTCGGCGCCGTA
TGAGATCTCAAACGAGGCAGATCTGTCTCCTTCTGGGGATGCTGTTGTACCCGCAGCGCCAGTGTTGGTGTCGGGACTATTGGACGAAAGCGCCGGGAGC
TTCCAGTCGCAGATCTCGTGCTTGAGCGAGATGCCGTAGCCGCGCACGGATCTGGACTTGTGGTCAGCGTTTACTGTTGCTTTTGTTGCTGTTTTCCACA
AAAGGTACTCTGAGAACCCGCCGGGACCCCCGCACACGTCCGCAAAGGTGAACGCAGAGTCCAAATCTGAGTTTTCTGCGCCATCGCTTGTTGTGAAGCG
GAAGATGTGATCCATGTTGACGAGCTTCATGGCCGAGCGATTGAGGAACCGTCCTCTACCCAACGACTCGTACGGATTCGCGGTACTGCGCGCGCGGCGG
AACGTGGCGCCGTCCAGTGCATCAAACCTGAGTCATTCAGTTAGATTGAGAATTATACATTAATATACATATGTCAGTAGAACATTCGAATCCAATCCAG
TAAAGTATCCTTCGCACCGATTCTTCTCGTCCTGGAGCTCGTCAAGCAACTTGTAGCACCGCGCGGGGAGCGGCCTCGTTGTGATTACCTCACTGTGGGC
ACTATCGCCACCGCCACCACCATGCTCAACAGTTGCAGTATCGCGCAGGAGAGCAGCTAGGATTCCAGTATCATCACTCATCTCACTCTTCACTAGGAAC
GTGACACCATGCGCGTCGAGCTTCAGTCGCTTTGCGTCAGCGCAGCGCTCGAGCTGCTCGTCCACATGCAGCTCTGTGCCTGGAACCACTTGTGTTAGCA
GCCACCGCGACGCATGCGCTGTATCTGTATCCGTCTGTTGCTGTGGCTGTGGCTGCTGCTGGCGACGCTTGTTGCGATTGCTTGCGGCGCCACCAAACGC
GGAAAACCCCATGAGCGCCTCCATTTCGTCCATCTCTTCTTGACTTGATCGTGTACTCCAGTTGCTTTAGAGCGCTCTATTTGAGACCCCCCAAGTTGGA
AATGGCAAACAAACATGTGAGCACAGCACCGGGGGCGTTGGATGAAAGTGTATATTGTACGAATCTATCTCAAAAGCGAACTACCAAATCTTCTTCTCTC
AAATGCAATCATCACTCACTCACTCTCACTCACTCAATTACTTGTGCGTCTGCATTCTTTTCTCTTCCTTCATACGTCTGCTCTGCTTTCTGGTAACTCA
CTCTGCTGCGTTGCTAATCAACCAATCGCTCTGCTCATGCACCTGCTTGGCTGTCGTGGCGAGTGGTGCGATTCATGGTCATACGGTGGTGCATCGAATC
CAGCTCTGCTTCTAATTGCAGCTCGCGCGCCACACTTTCGCTCAGCAACTGCTCCAAGTAC