Description :
From Genome Similarity Track
Location :
Scaffold_161:135020- 137173
Sequence
2153 bases(100 bases per row)
CCTCCTCCTCCTGGCCCACATCCCACCTGTGGGTCCTTCTTCATCCTCCCATCGATATGACCGGCTCACAACCATGGATCTCTCTACTCCTCTACGTGAG
AATGCATCACGCCAAATCGATTTCGATTCGTACGATCCCGCAAGAAAGCATAGAGTAATGCCCCACAGTTCCGATCTAACTCGTTTACCCAACCCATCTG
GGTTCGTCATATCCTCGCCAATTTACCAGAAATTCGTGGTAAATTCGTCAATGTCTGGTTTGTTTCTCTGATATCATGTCGGCGATCCTCTCGACTTCGA
ACTCGTCAGCTTCGAGATTTACGTTCCAACAATTCTCCGGTAGGATAGCCTCGTCAAAATCCATTCGGTTGGACTGAAAGATGGATCTCAGGCCGGTCCG
GATATTCTCTGACCAGTTTTAGCTTGGATATGTGTACTACGGGGAACAAGCGATATTCGGTACCTGCCGTTTCCAACTTCACGGCGTGTTCCCCTATCTT
TTCACGTACTCGGAACGGTCCGTGCCAAAGATAGGCCAGTTTATGGGCATATCATTTATTTACTCGATCAAAGGTACAGCCACACCTGCGATCCAACTTG
GATTTGATGTGGACGAGCTTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTTCGCAACCGTTCGTTCACTTGGGATCTGGCTTGCCGGTAGTAT
TTCTGGACTTGGTATCGCCATCGCCTTGGGTCTCGGTTTATCCTCTTGGTATAGTCCACTGGAATGGACGCTTCCAGGGTGGATCTAGGATCTCATCCAT
GTACCAAGTAGAACGGGGTATCTTCCCGGATCCTGTCTTGTGCGGTATTCATTGCGAAGGTAAGCCGTTCTGCGTATTCATCCCAGGCTCGCTGATCCAA
ATCTTGGAAATACATCTTGAGCGCCCTTGTGATCGTCTGTACCATGCGTTCGGCAGATCCGTTGGTTTGAGGGCGATATGCCATAGTTGCCCGCTGTCTC
TGTCCAAGGATCTTGTTGAAGACTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATTATGTCTAATCGTCTCGCTAGCTCCAAATCTTCGGAAAACGC
ACTCCTCGTACGATTCGGCAATGGTTTGTGCAGTTCTAGACGCACTAGCTTTGGCTACCACGTATCCGGTAAACAGGTCCACCCAAATCAACAATTCTGT
GTTTCCTTTGAACGACTTGGGCAACGAGGGGATGTGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGACATTCCCACGTGACCCCCTTCGATTG
TGGGCCTGCCCTTGCCTGTCTCACAATCCACACACTCACCGACATATCGTTGCACACTCTTGAATAGTCCCCTCCAGTGGAAACATTCCCGGATCCGTTG
GTAGGTCCGACCAATCCCCTGATGTCCGCCTTCTAAACTAACGTGATAGTGATGTAGGACATCCTGTTGTAAGGTTTGTGGCATCACCAGTCTCATCAAT
CCGTCCCGATCCTCGTTGACCCTCTTCGTAGGGGGACAATAGAAGAGCAAGTCATTCAGATCCACTGCATAATCCGTAGCGATAATACTGTAGGATTTGG
TATCCTCCCGACTCAGGTCTCGTACATCCCCCATCCGATACTTCTTTAGTCCCAAGATCCACGCTTCTTCGTTCTGTGCTTTGAGGATCCGCTCAATGCG
GACTCCTTTCACAAATGTTTCACCGAGAACCTGGGGGCTGGATCCAATCCTCCCTCTGAATCTAGTGACCGCCATTACCTGAACTGTCCTTTTCCCGGAT
CCAACCACCACCACTTCGTCTAGTCGGTTTAACGTAACGAGATCCTGATGCTCGGCTTCTCTCTCCACCTCGACACCTCATTGATTCCGTAAAGCGGCAC
TGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCACGCAGGTGGATCATCACTTTCTGTCGTAACAG
TGTTAGGGCCGGGGCCTTGCCGTCAATCTCACCTCGCACCTGTCTGATCACCAAGTTTGAATCTCCACAAATCAATAGCCATTTTGGATCTTGTCCCTTT
AGTAGATCCAAACCCAGCAGGAGCCCGTTATACTCCGCTTCATTGACGGTGAG