Description :
From Genome Similarity Track
Location :
Scaffold_76:135014- 136392
Transcript NameFunction/comments
g13535.t1ETL97001.1 hypothetical protein L917_05643 [Phytophthora parasitica

Sequence
1378 bases(100 bases per row)
GGGCCAGCCATTCTTCGCTCATATCCCATCGAGCCCAGCCCCGACACAAGTCACTCCCCCAACAGAGCAGGAAACATGGTGCGCGGCAAGAAGATCGGTC
TGGGCGAGTTCCTGGGCGACCAGGCGGCCGCTTACATCCCGGAGGCGGCGCTGCCCTCGGGCCCCCGCGCGCGCGCCGACGACGACGACGGAAACAGCTT
CCGCGGCGGCCGTGGCGGCGACCGCTACGGAGACCGCGAGCCGACGCGCAGCGATTCGTCGGACCAGTGGCGCGGAGACCGCAGCGGCGGAGGCGACCGC
TTCGGTGGAGGCCGTGAGGACGGCGGTAACTGGCGCGGAGGAGGCGGTGACCGCTTCGGCGGCCCCTCGCGCTACGACCGCCCGGCGCGCGACGACTTCC
AGGCCGAGGAACGCCCCGCTCACATGCGGCTAAACTTGGCGCGCCGCGGAGAGGGTCCCAGCGGCGACGCGCGCAACAGTAGCGGCGACAAGTGGTCTGG
CGCGTTCGGCGGTAACAGCGGCGGAAACAGTGGCGGCCGCTTTGGAGACCGCGGCGGTGATCGCTTCGGTGACCGAGGTGGCGACCGGTTCGGAGACCGG
GGTGGTGACCGCTTTGGAGACCGGGGAGGCGACCGGTTTGAGGGCGGTGGTCGCGCGGCCGGACGCTTTGCGCGCGGAGGAGACGACGTGTCGTCCTCCT
TCTCGAACATGCGCGTGGGCGGGCGACAGGAGCAGGCGGCGCCCGAGCCGCAGATGTCGGACAAGAAGCTGCGCGCTCAGCAGAAGCGCGAGGAGCGCAA
GAAGAAGGCAGAGGAGGAGCGTCTGGCAGCTGAGGAGGCCAAGCGCGTCGCGGCGGAGGAGAAGAAGAAGGCGGAGGAAGAGGCGGCTAAGAAGGCCGAC
GTTGACCGCGAGACCTTGAAGCAGGTGCTAGCGAGCGGCAAGAAGGGCGAGGCCCTTGCGGACGTGGCCAAGGACGTGTTTGCTAAGAACGGACGCCCTA
GCGGCGCTGTGCTCTTCGAGGCGGTGACTACCGCTGCGGAGGACGTGGCCAAGGCCAGCGCCAACTGGATCGCCTTGCCGGCGTATGGCGAGCTGCTCAA
GTTCGGCATGGAGGACGCGGACAAGAAGGACCAGATGGAGGCGCTGTACGCGCTGCAGATCTTCCTGAACAAGCACGACTTCCCCAAGGGTGTGTTTGAG
AAGTGCTTCATGGCCCTGTACAGTCTGGACATTATCGACGAGACAGGCTTCTTCGAGTACAAGTACGACGTGGACGGTGACGTCCCCGGTCGAATGAAGG
CTATTATCCAGACGTCGTCGTGGCTCACGTGGCTCGAGACGCCCGAGGAGGAGAGCGAGGAGGAGGACGAAGAATAGA