Description :
From Genome Similarity Track
Location :
Scaffold_161:135010- 137180
Sequence
2170 bases(100 bases per row)
CATCAGTGATCCTCCTCCTCCTGGCCCACATCCCACCTGTGGGTCCTTCTTCATCCTCCCATCGATATGACCGGCTCACAACCATGGATCTCTCTACTCC
TCTACGTGAGAATGCATCACGCCAAATCGATTTCGATTCGTACGATCCCGCAAGAAAGCATAGAGTAATGCCCCACAGTTCCGATCTAACTCGTTTACCC
AACCCATCTGGGTTCGTCATATCCTCGCCAATTTACCAGAAATTCGTGGTAAATTCGTCAATGTCTGGTTTGTTTCTCTGATATCATGTCGGCGATCCTC
TCGACTTCGAACTCGTCAGCTTCGAGATTTACGTTCCAACAATTCTCCGGTAGGATAGCCTCGTCAAAATCCATTCGGTTGGACTGAAAGATGGATCTCA
GGCCGGTCCGGATATTCTCTGACCAGTTTTAGCTTGGATATGTGTACTACGGGGAACAAGCGATATTCGGTACCTGCCGTTTCCAACTTCACGGCGTGTT
CCCCTATCTTTTCACGTACTCGGAACGGTCCGTGCCAAAGATAGGCCAGTTTATGGGCATATCATTTATTTACTCGATCAAAGGTACAGCCACACCTGCG
ATCCAACTTGGATTTGATGTGGACGAGCTTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTTCGCAACCGTTCGTTCACTTGGGATCTGGCTTG
CCGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGGTCTCGGTTTATCCTCTTGGTATAGTCCACTGGAATGGACGCTTCCAGGGTGGATCTAGGA
TCTCATCCATGTACCAAGTAGAACGGGGTATCTTCCCGGATCCTGTCTTGTGCGGTATTCATTGCGAAGGTAAGCCGTTCTGCGTATTCATCCCAGGCTC
GCTGATCCAAATCTTGGAAATACATCTTGAGCGCCCTTGTGATCGTCTGTACCATGCGTTCGGCAGATCCGTTGGTTTGAGGGCGATATGCCATAGTTGC
CCGCTGTCTCTGTCCAAGGATCTTGTTGAAGACTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATTATGTCTAATCGTCTCGCTAGCTCCAAATCTT
CGGAAAACGCACTCCTCGTACGATTCGGCAATGGTTTGTGCAGTTCTAGACGCACTAGCTTTGGCTACCACGTATCCGGTAAACAGGTCCACCCAAATCA
ACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATGTGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGACATTCCCACGTGACCC
CCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACACACTCACCGACATATCGTTGCACACTCTTGAATAGTCCCCTCCAGTGGAAACATTCCC
GGATCCGTTGGTAGGTCCGACCAATCCCCTGATGTCCGCCTTCTAAACTAACGTGATAGTGATGTAGGACATCCTGTTGTAAGGTTTGTGGCATCACCAG
TCTCATCAATCCGTCCCGATCCTCGTTGACCCTCTTCGTAGGGGGACAATAGAAGAGCAAGTCATTCAGATCCACTGCATAATCCGTAGCGATAATACTG
TAGGATTTGGTATCCTCCCGACTCAGGTCTCGTACATCCCCCATCCGATACTTCTTTAGTCCCAAGATCCACGCTTCTTCGTTCTGTGCTTTGAGGATCC
GCTCAATGCGGACTCCTTTCACAAATGTTTCACCGAGAACCTGGGGGCTGGATCCAATCCTCCCTCTGAATCTAGTGACCGCCATTACCTGAACTGTCCT
TTTCCCGGATCCAACCACCACCACTTCGTCTAGTCGGTTTAACGTAACGAGATCCTGATGCTCGGCTTCTCTCTCCACCTCGACACCTCATTGATTCCGT
AAAGCGGCACTGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCACGCAGGTGGATCATCACTTTCT
GTCGTAACAGTGTTAGGGCCGGGGCCTTGCCGTCAATCTCACCTCGCACCTGTCTGATCACCAAGTTTGAATCTCCACAAATCAATAGCCATTTTGGATC
TTGTCCCTTTAGTAGATCCAAACCCAGCAGGAGCCCGTTATACTCCGCTTCATTGACGGTGAGGCGGTTG