Description :
From Genome Similarity Track
Location :
scaffold_4:13501- 16362
Transcript NameFunction/comments
Pl_112870conserved hypothetical protein
Pl_112871hypothetical protein PHYSODRAFT_313188

Sequence
2861 bases(100 bases per row)
ACCATTTAAGAAGCAGGAAACGCACCTTAAGTCCTGCAGCCAATGTGAATTCCTTGCTCATGGTCATCAACGGCACAGTTTGAACAGCAGTTGCTAGCTC
TTGAAGTGATGACACGAGATCAACGTTAGGGCTAACCAATGCCAGAAGATACGATCGGCCCTCATCAACACCATAAGTCCTGGCCTTTATTGCAATACTA
ACTCCATTGGATTGCCCCTGTTGAATTCGGGAAGGGGATGGAGCCAATGTTGGGCCTGGACTCCCAACAGCCTTAGCGTCAGTAGGTCCAACCTGCTCAA
GAGCAGCACCCACTGCAAAGGTCACTCGTTTCTTGGTAACAACAGTTGCTGGACCCAACAGCGAGTTTGTCTGACGTAAAATGGAAGTAGTGTTCGTTCG
AACAGCAACATTATTGTTGTAAGCATCGTTTTCAGGATGCTCTGGACTCACATCAACTGTCATGTCCTCTACAGGATGTTCCAGTTCCTTCTCAGATGCC
AAGGCAACATCCTTGCCCACATGGTCTTCCTCACTTGTGATCGCTGCATACCACTTCCGAAACTTGTCGGTAAACTGAAAGGTTTTGTTTTCCATCAAAG
TATTTCTCGTGTCGCCCGTCATAATTTTCACATACATGAGCAACTGCTTGGCCGAGTTCAGTTTTTTCACAGCCCCTCGATCCTGCTGGATGATTGTGCC
ATACCGATTGACTAAGTGCTGATGATGTGTCGATATCTCGTCCAGGACACGTAGGATGTGTCCTGGAGTGCGTCCTTGTCTCGGATCCGGCTGTACCGAC
GCTCCCATGCGAACAAAGCGCAGCACCACCGTCCTCTTGGTGGATTTATCTAGTTCCTTCTTAATAGTGACTTGAGATCCCACAGCCTTCACCTCCTCAT
CGAGCTGCTTTATCTTTCTTGGGCAAATGAGGAAATCCTGGTCTTCCATTCCCACTAAATAGTCGTCCTTTTCGACAGTGCAGATGGAGGTGTTGGTAGA
AGATCGTCCAGCCACTTTGTCCGCGAACTCCATCGGATACTGCGGCGACTTGATTTCCTGTACTTGAAAGAGATGTGACTTCATAATAGAGGCCACTGAG
AGCCCCAAGTGAGCGCCCAGCTGCAGATTGTCCACCGAACCGCGAGGCAGCGTGTAGCAGACCTCGTAGGCGCGACCGAGCGACAACAACTTTCGCGTAG
CTAAAGCGACCTCCACTCGCCACAGACGCACATCCATGTCAAACGCCAGCGCTTTGTTAGGCTCCATGAGTGCTGCCGATGGCTCGGAGCTCTCTGCGAA
CGGGGCCATTGCTCGTCGACTTTTGGCTACTTCGACACTGGATAAAAACCTCTGAAAGCAGAGTCTGCGAGATTTCATAAATTATGTAAGGATAGAGGTA
GGACAAGCGACTTCAACGAGAAACTGCGTTAGCTTTGCAGGATCCATTGGCTAGGAGAGTAGCAACAGCGATAAACTAGTGTCATTTGCATCGATTGTTG
ATGGCTCATCAAGACGCTACTCCATGAGGAAAATGCGGCTGGCAACATCACCGACGAGCCAATCGATACCGTCGACAAGGCCACTACCAGTGACGGCGCT
GCAGGAGATGATGCTCCAGTGTCGAGTAGAGAATTGAGCCGATCGGAGTCCGAGCGCGTCTGCAATTTCTGCAGAAGAGAGAGCGCCAGGTAAATCCTGC
TTGTTGGCGAAGATCAGCAGTGTAGCTCCTGCTAGTTTCTGGAGGCCAAAGTCGAGGAGTGAAGCAGAGGGATTAGCAGTGAACCACAGGCAGAAAAATA
ATACTGATAGTGCACGCACCTCTTGAGCCAGCAGGCTTGTGAGCTCGCGCTTGCAGTCGTCAAGTCTCCTTCGATCAGCGCTGTCTACCACCCACACGAT
ACCATCCGTCTGTTAAATCACACATAATTAGCTCGCCACTCCTACACATATGCAAACAGTAGATCGAGCCTGCTCAAAGTAATTCCTCCAGTACGACCGA
ATTGTCTGCTGGCCACCAACATCCCACACATTCAACTTAAAGCTGGCAGTAACATCAGTTAATAAGTCTCTCACGACCGACTCGTGGAAAGTATACCCAC
TTACTCCTTGTACTCGAGCGTCTGGATGTCGAAGCCCAGCGTCGGAGAGATTTCCGTAATATCCTGACCCATGAACTTTTTCAGAATTGTCGTCTTGCCA
GCATTGTCCAGGCCGCTGGGGATCGAAATCAAGCCATAGTAAAGCCATCAGCTCCAGTCAGTTAGCGTCCTTAGAGCCAAGGCAGCAACGTACAGCATAA
GCACGCGGATCTCCTTCTCTTTCTCCTTGACTTTCTTGAGGATACTCAGCAGCCCCATGACATCGAAATACACACTTGGGACGTTAATGCGATATTTACG
TTTGATTTTTACTGCAATATTCACGAAAAGACACGAAACGACAAGAACTTCAAGCAGTAGACGACGAGTAGCAGTAGTCGACATGACCAAGGGAATTCCT
CCAAGACACTCGCTGTTTAAGAGACGTGACGGCAACCAGGAGGATGCGCACGCGCTAGAGTCCAGTGCTCGGTCTTTGAAAATCCACATTCCACTGCAGC
AGCAGCAGTCTCCAGACCAAAACGAAAGGCGAGATTCAGCCAAACTGACGCCACTCGAAGCACTGCTAGATTTGGAGCTTGACTTGGTTCTTCCTGCAGC
TGCAGTACCTGCACCAGTGAGTAATCAGTTGACAGCTTCAACAGCGAGGGATAAAGAGCTGGCAACCAACATCGATGCACTTTCGTTGGAGTTCCTGGTG
AGAGTGAAAAACGCTGTGTTCAATCATCGACGATGCCTCATTTTGTTGTACGTTATGCTGC