Description :
From Genome Similarity Track
Location :
scaffold_1193:135- 5998
Transcript NameFunction/comments
g11143.t1 reverse transcriptase

Sequence
5863 bases(100 bases per row)
GGGCTGGGCGTATCTCTCGCGTGGTAGTACTACCACGCGAGGAAGAGATCTGACGAGTCGCCGCTCGAGTATCTCCATCGCCTGACCGTGTTAGGTCTCC
GAGCCAAGTTGCCGATCAAGACTGGACCGCCATCCGCTCTCCGAGAACATGTGGAACACTTCATCGAAACCTTGGACGATCGCGATCTTGTGGACCAGTT
AACATTGCTGGCCTCGCAGATGGAGACGCCCTGGCAGACGTGTTGCGCTTGCGTCAGCGTGCGAAAGCCCGACAAGGCAAAGCAGCCGCTGGATGAACCA
AGTACCGCCAGAAGGCCCCCTCGGCGCCTCCGCAAGCCTCGTCCAGACATGCTCGAGCCGTGGGTGCGATTCGCATGACGAGCGACAGCGACAGTTCGGA
ATCGGAGTCAGAGTCAGGAGGATCGGACTTGGATCAAGGCCGATCTCAGGTCTACCTTGCTGCTGTCGTGGACCAACGGAAGCCGGAAGATCAACCTCAG
CAACGCCGTGATCCTCAAGGACCGCTGAGCAAACCGGATCAGCCCCCTCGCCCCCGGAATGAAGATCGCGTGGAGAAGTGTTCCCACTGTGGGTCCACGA
GACACTCCGATCTTGGGTGCTGGATACGCTTGACTTGTCAGAAGTGTGGCAGAAGGGGCCATCCTGGAGATCTCTGTTTGTACGTTTGCCGAGCGTGCGG
TGAAGTTGACGAGGCCGGCGAATGCCCGGTGGAAGAGTTTTACAACTTGATCCGCCAATGGTACGATCCCACGCGTCACGCCGGGATATTCCCCTCGAAG
GCGGAGAAGATGTTAAACTAGAACGCTCGCCAGGTTTGAATCTGGTACGAGCCGAGCGTTCTAAGTTCTGCATATTTGCATACGTTGACAGGCAAGCGAA
GTCGAAGGTCAGTTCTTCGAAGGATCCTATCAACAATACATACGGAATTCATGAGAAACGTACCTTCACGATCGCGAGCCTGCGGAGGGATAAGTATGCG
CGATCGGATGTTGTGATGGAGTTGGACTTGGCTGATGGAAAGACCCGTGGATACTGGAAGGATCATGCTCCGGATACGAAGCCCGGAGAACTCATAGCCG
TGAACTCGTTGACGAGGACCCCGCCGGACCTCGGCTGGGACCTCAGACCGGGTGAATCGCGAGGATACTGGAAGTATTACTCGCCCGGCAAGTGGTTCAA
GCAGGCGAAGATCACCGGGACGATCAACAACTCGAAGGTGACAATGCTGTTGGACTCTGGCGCAGAAGTCTCAATCGCGGATACCACCTTTGCTCGTAAG
GTTGGCTGTATCATAGACGAAAGTCAGAGACAAGAATGTGTTGGAATCGGAGAGAACGTGTATACGACCTTGGGACGTACCACGATCAAGGTCACGCTGG
CTGGATACTTGGTCTACTTCTTCGACGCCTGTGTTGGTGCCTTGGCTGGCAGGACGCGATCTTGGGCATGGACTTCATGGTCCCTGCCGGGATCCGGCTA
GATCTCGCGGACGGTACGATGTGCTTGGCCGACGAGGTCCAAATTCAGCTGTCGGGACGACGCCTGCCGTACGGCCGAAGCAGGCACTCGCTATTGCTGG
AAGATGACGTCGCGATTCCCGTCGCAGGATCTGCCGAAGTTCCCCTGAAACCACCACGCGCGTTCGAGCGAGAGAAGTTGTGGATCGTGCGTGGAGAAGA
ATGGGTATCTACCGTCGTGAAGGGCCTTAGGCGTCGACAACACCTGCGGATCACCAATGTCGGTGAGCGGGAGCTCCACCTGTCGCGAAGTACCGAACTG
GGGATGTGGCTGGCCGAAGATCTTGTTCCCCGTGTGCCAGATCATGTATCGTTAGGATCGCGTCGATATGCGGAGTGGCAAACTCTCGCGTTCGAAGCGA
CCACTGATCGGCAGGAACAAGAAGAGCCGCCGCCCGAGTCCTCCGAACCCTTGGTGGATCACCCTCAGTACGACCCTCCGACGAAGGTGAAACGTTACCC
CGACCAGTGGTCGCAACGACGTCCGTACGTTGGGCCGGACCTTTGGTGACCAACGAAGAGACCCCAGAAGTCAAACTGGACTCGAGGGAAGAAACCGCAA
TCCGAAGTGATCCAGAGATCGCGAAGAAGGAAGGCGGTGCCGAACCGGAAGCTGACCTCACCTTGGACCACGAAGAGACGGTGACCGTTCTAGTCGACGA
CGTCGCTACGGAAGAACCCCAGGAAGAACCGAAGGGTGACGCCTCGGAAGAACCCGCCGAGATTCGGGAGGATGCCGAAGGGTATTACCACGATGGTGGG
AGCCACGTTGCGGAAGATCTTGAGGGACAGATGGCTGTCCTGCCCGAGATCGTGAACACGACCGAGGAAGTCAAGATCGAAGACATTCGGGCTGGAGATC
CCCAGTGGAACACTCCGGAGGAGATCAATCGTTTGAGACGCATCATCTGGAGGCGGAACCATCTTCTGATCGGGAAGGGGAACGCCTTGCCACCAGCAGC
AGTTAGAGTAGTTTGCGACATCGACGTGGGAGGTGCGGCCCCGATCGTGCAGCGCGTTCGCCGGGTAGCCCCACAGTATCGCGAGAAACTCTCCGACCTC
ATCAAGGGTCTGTTGGCTGCGAAGATCATCGTCCCCTCCACGTATCAGTGGGCATCTCCAATCGTGATCATCATCAAGAAGAACGGGGTGGACATCCGGC
TCTGCATCGATTACCGCCTTGTGAACTCGCTCACCAGATTGATGGTGTACCCCATGCCGTTGATCAACGATCTTCTCGAAGATTTTGACAAAGTTCTCTG
GTACTGTTCCTTGGACATGGCGAGCGGATTCTGGGTAGTCCAGATGACGCACGCGCGCGGAAGATCTCGGCGTTCATTACTCTCTTCGGATTGTTCGAGT
GGACCCGCATGCCGTTTGGATTGAAGAACGCGCCGCAGATCTACCAGCGGTTGCTGGACAATGCCCTGTGTGGATTCCTCCGGATCGGCAACGGCAATGG
CCATGAAGATCATGCTGACGTGTTCGAGTCAGGCGAGCCGGAGATTGACTACAAGCCTTCGGTACTGGGACGGCGGTCGTACATTGACGACATCCTGGTC
ACTGCGGACTCGTGGGACAACCTATGCGAGAAGGTCGAGAAGCTGCTCGACGCCTGCGATCGCTGGAACTTGTTTATCAATGTGGTCAAGAGTTCTTGGG
GCATGCGCAAGGTGGACTATCTGGGTCACCGGGTCTCGATCGAAGGACTTGAGGCGCGGTTCAAGGATTTAGAGTTGTTGTGCAACTTGCCGTTCCCGCA
GACACTGCGCGCGATGCAGTCGTTCCTCGGTAGCCTGAATTACTACAGCCGCACCATTGAGGACTTCGCAGCGTATGCCGCGATGTTGTACGAGCTGCGT
GAGACGGACTTCTTCGAGCTTCGCCGCCGAAGCAGGATCACGGCCATCCGCTGCAGACAGGGGATGTCGACCAAGTGGAGAACGAAGAGGACCGCTGGAC
GAGAGCCGCCGTAGCGTTCACCATGCTGAAGGCGAAAATCGTGTCAACCCCGATCCTGAAGCACTTTGATTCCGATCGCTCCCCAGTGATCGTGGTCTAC
GCGAACAAGTGGGCTATCTCCGCGGCTCTCATGCGAGAACATGATGGCGTGTTCTGGCCAGTGACCTTCACCAGTCGAATCTTGAAGGCGAACGAACTCA
ATTACGGGATCGTCGAGAAGGAGGTCTTGGCCTTGCTGCGGATCTTGGACGTCTGCCACACCATGCTGGTCACCAAGCCGATTAAGGTGCTGTCGCGATA
CTCGACACTGGGTTGGCTGCTTCGATCGTCAAACCTTCAAGATCGGTTAGGTTCATGGGCCGCACTATTATCCCAATGGACGTTGGAGATCGTGCGATGC
AAGAAAGGCGAAGACGAGGTGTTGGGGACGCTGGCTGCGAGCATCACCCCTCGGGAAGAGGTGGACGAGGCTCTGGTTGCAGCCGCCCCTAGGAAGCAGC
CCTGGCAAGTGATCGTCGCGCCGACGCCAACAGTTGAACTGGATGAAGAGCTGATCGTCGTGAGCTTCGACGGATCTGCCCGTGTGAAACGTGGCGGAGG
AGCATACAGCGCTGTCATCTGGAAGTTGCCCGAGTGGACGGTCCTCACGGCGGCGTCCCAGTACGCGACCGAGATGACTGTCAACGAAGCTGAGTACCAT
GGATTGTTTCTGTGCCTGGATCTCCTGTCACCTTTCGACAGGGGACGCTTGGTGATCTGCGGGGATTCCAACTTGGTGATTCGGCAGATGCGTGGCGAGA
TCGCATGCAAGGCGCCGGCGCTGCAGCTCCTGCGTGAGAAATCGATGGGCAAACTCTCGTCGTGTCCTCAGCACGAGTTCGTGCACGCGAAGCGGGATTG
GAACCAAAGCGCAGATCGTCTCGCCAGCGAAGCCTTACAGGCGGAAGCAGGGACGGTCGTGACGTCGATCGAGGTCTTCGAAGACTTGATCACCCTCAAT
CGGCTTGGGGAGATCCTGAAGCCGAAGAACGATGAGAGCGTAGTCCGTGTCTCCGCAGTGACTCGATCGTCCACACGACGGCGTGCCCCACCGGAATGCC
TGCAAGAATCAGTGGTTCAAAGCATGAGGTTAGAACGCATCGCCAAAGCGCAGGCCGAGGAGCAGTGGATCGCGGATTTGAAGACGTACCTGACCGGGAA
CGTGGCGGATCTGGCGGCGAAGGACGCTCGAACTTGTGTGAAGATCGCTGACTTATACGAGGTAGATGACGATGGAATCCTGCTTTATTGCCCAATCTCC
ACGCTCAAGTCGGACGAAGATCGCGATACGATCGCCAAGCTGGTGATCTTGGAATTGCTACGCCAAGACTTCCTGCATCACTATCATGCGAGCCTCGAAG
GCGGGCATCAGGGGATCGGAAGAACTTACGCGCGGATCAAGCAACACTTCCACTGGAGGGGTCTGTTCCGAGACGTACAGAGATACGTTGGTGAGTGTGT
TGACTGCGAGACTGGGAAAGGAAGACCTACCATTCAGGGAAGACCGCCCGGGAATCTGCAGGCCACCTACCCGTTCCAGATCATCGCTATGGATCACATC
CCTTCACTTCCGAAGTCGTATAAAGGGAACACGGAGCTCTTGATCTGGGTAGACCTGTTCACCGGGTACGTGCTGGTGAAAGCAAGCAGCGCCCGAACCG
CGCAACAGATCACCGAGAGCTATGAAGAGAGTGTCTTCCGTCGCTTTGGAGCGAGCGAAGTCATCCGGCATGATCGCGAGCCCGGGTTCATGGCGGATGT
CTTCCGGGCGTTCAATCGTATTGTGGGCCAACGGCAGAGCCTGACGATGGCTTACCGCCCTCAGGCCAATGGAACAGCAGAACATATGGTGCAGACGCTG
ACTCGATCAGTCAAGATGTACGTCGCAGACATCAACCAGAAGGACTGGGACGGGTATGCAGAGCGGCTGCCGTTCGCGCTGAACACGGCTCAAGATCGTG
TTCGGGGAGATACGCCGTTCTTCCTTGTCCATGGTTGGGATCCAAGATCCACTCTGGAAGCAGCATTGCCTGTGGGGAACACGCGTCGCCGAGATCGCGA
TCCACGGAGATGGTGTAACCATGTGCAGAGCCACTACCAGCGAGCTCGTGAGGAAGTGAACGAACGCCTACGCGAAGCCATCCGCGGACGAGCTGATCAT
CACAACGAAGATCTTCGTCCACACCACATCGAGGCTGGAGATCAAGTCTGGCTGTATCTGGACCGCGTCAAGGTTGGCTATGCTCGGAAGCTTGCGCACC
TCTGGCATGGACCATTCCGTGTTGCTGAGATGATCGACCAACATGCTGCGAAGCTGGAGATCG