Description :
From Genome Similarity Track
Location :
Scaffold_1164:135- 4420
Sequence
4285 bases(100 bases per row)
CTTCCTCCTAATCCACCCTTCCCCTGTGGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCACATCAGCGATCCTCCTCCTCCTGGCCCACACCCTT
CCTGTGGGCCCTTCTTCATCCTCCCATCGACATGACCAACTCACATCCATGGGTCCCTTCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTTA
CGGGTCGTACGATCCCTCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTTCCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATACACCA
GAAATTCACGGTAAACCCGTCCGTATCTAGTTCGTTTTCCCGACCTCATATCGGTGATCTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATTCCA
ACTATCTTCCGGTAGGAGGACTTCGTCGAAGTCGACGCGATCGGATCCATCCACCGAAAGACGGATCTGCGGCCGATCCGGATATTCTTTGACCAACTTT
AGCTTGGATACGTGTACTACAGGGAACAGGCGATTTTCGGTACCTGCCGTTTCTAGCCTTACCGCGTGTTCTCCAATCTTCTCGCTCACCCGGAACGGTC
CATGCCATAGATGGGCCAATTTGCGGGCGTGCTTCTTTCACCCGATCCAAATAAAGCCACACCTGCGATCCCACTTGGATTTGATGTGGACGGGCGTCTT
CGTTGTGTCGATCCACTCGATCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCG
CCTCGGATCTCGGTTTCTCTTCTTTGTGCAGCATACTGGGATGGCCGCTTCCAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGGGTATCA
CCCCGGATCCAGTCTTGGGCGGTGTTCATCGCGAAGGGAAGCCGCTCTGCGTACTCATCCCAATCCCTCTGATCCAAATCCTGGACGTACATCTTGAGTG
CTCTCGGGATCGTCTGTACCATGCGCTCGGCCGACCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGATCCGGTTGAATGC
TCGAAATAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATCTCGCTAGCTCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCGGCAATG
GTCTGCGCAGTTCTAGACACACTAGCTTTGGCTACCACGTATCCGGTAAACAGGTCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCA
ACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATATTCCCAGGTGACTCCCCTTAGATTGTGGACCTGCCCTTGCCTGTCTC
ACAATCCACACATTCCCCGACATACCGCTGTACGCTTTTGAATAGTCCCCTCCAGTGAAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGG
TGTCCGCCTTCCAAGCTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTC
TCTTCGTAGGGGGGGGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACCGCGTAATCCGTAGCGATAACGCTGTAGGATTTGGCATCTTCCCGACTCA
GGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCTAGGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCGCTCGATGCGGACTCTCTTCACAAA
TGTTTCCTCGAGAATTTGGGGGTTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTCCTTTTCCCGGATCCCACTACCACCACT
TCGTCTAGTCGGTTCAACGTAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTCAACACCACATTGATTTCGTAAAGCGGCGCTGGCCAAGCTATCTG
CACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAAACACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGTC
CTTGCAGTCAATCTCACCTCGCACCTGTCTGATCACCAATTTTGAATCCCCACAAATCACCAGCCTTTTCGGATCTTGTCCCTTTAGTAGATCCAATCCC
AGCAGTAGCCCGTTATACTCCGCTTCGTTAGCGGTGAGGCCTTCCGCATAAGTGGATCTGGCCCGTACAACTTCCCATCCAGGTAGTCTTCACAGTATTG
CACTGTACGCCCCGCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCGTCTGCCTGTACCGTCGGGATCGGGATCTGGAT
CCGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCCTCATCCATCAGAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCT
TCCCCTTTCGAACATTTCACAATCTCCAGCGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAGCCAGG
CTAGCGTAGAGTGTCGGGTCAGGATCCGGATGGATCTTCCCATCAGCAGGTTGTAATTCAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCAC
CGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGTACTAGAGCTGCTGAGACTGCC
CAGTCGCTGGCATAAACTATTACCGTAGGTTGACGTTCTGGATCGAAATGACGGAGGACGGGCGTTGTCGCGATCCTGTTCCTCAGTTCCACGAATGCGT
GTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCATGTTCTGATCTGTCGTCTCTACCCAGACTGGATCCTCTCTCCGTTGGTCCCGGGGTGGATCCAG
CTCCTGTTTCAGGTCCTCTTCTGGCGTCGTACCACTTGGATCCCTTCGTGGATCCGACATCTCCCGGGCCAGAGCTTGTTGGATTTTTATCCGGACAGCT
GGAGTGGTCATCGCAGCAAAATCTACCTTTCTCAATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGGCTGTAGTAGTTCAAACTGC
CCAAGAAGGATTGCATCGCCCGTAACGACTGCGGGAAGGACAAATCGGCTAGCGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAACTCG
ATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTT
TCGCACAACTGATCCCACGATTTCGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACGGACGGGGTTCCAGGATCCCCTGGCTCTCCTG
CCTCAAATGGATCTACTTCCGTATGATCTTCCCCGGATCCACCCCTTTTGGGTTCCGGTATTCGGGTGAATCCATAGAGAGCGTTATCGATTAGGCGTTG
GTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAATGCGGATATCGCGCGAGCTCGATCCGTC
ATAGTAACTACCCAAAAACCGCTGGCCATGTCAAGAGAGCAGTACCAGAGTACTTTATACAGATCTTCCAACAGCTCATTGATTAGAGGCATCGGATACA
CCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGGGATGCCCACGG
GGACGTTGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGATAGTTTTCTTGGAACTGAGGCGCCACCTTCCTCACCCTCTGAGCGA
TCGGTTTCGCGTCACCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGAT
TTTCTGACGCAGACGATCCACTTCAGCTGGTTCATTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGGG
ATCACCGCCATGCCTTCTCCCAGGTCCTCGGCGTGTAGATCCCCGCCTTGTAACAAACTTGCTCATCTTCCGTCTTCGTAGGATC