Description :
From Genome Similarity Track
Location :
Scaffold_2165:135- 3521
Transcript NameFunction/comments
Phyta_totarag14185hypothetical protein

Sequence
3386 bases(100 bases per row)
AACGGCCATGCCACAGATGGGCTAGTTTCCGGGCGTAGCCTTCCTTCATTCGACCCAGATACAGCCATACTTGAGATCCAGCCTCGATCGAGTGCGGTCG
AACTCCTTCGTTGTGCCGATGAGCTCGATCAGAGATCGTGTCTCGCAGCCGGCCATTAACCTGTTCTCGGGCTTGCGTGAAATGTCGTTGGATCCGATAT
CACCACCTCCGGGGATCGCGATCCTGTGTTCGGGTGCACCCCAGTGGTATAGTCGCCTCGAGTGTCGATCGCGGACCCCATCCGTGCACCAGATAGAAGG
GTGTATCTCCACGAACCCGATCTTGAGCCGTGTTAATAGCGAACGTCAGTCACTCCGCATACTCATCCCAATCTCGTTGATCTAGATCCTGAATGAACAT
CTTCAaagctctcgtcgtcgtctgtaTCATTCGTTCTGCGGTGCCGTTCGCCTGAGGTCGATAGGCCATCGTGGCCCGCTGACGCTGTCCGATGATCTTA
TTAAACGCNGGTAGTGACGGTATGTGATCCATCGCGATGATTTGGAACGGGTACGTAGCTTGGATGGTTCCAGGCGATTCGCCCCTGATCGTTGGTCGTC
CCTTGCCAGTTTCACAGTCAACACATCCGCCGACATACTGCTGCACACTACGATACAGTGGAAGTGATCCCGGATCCGCTGATAGGTACGCCCGATCCCT
TGATGGGCCTTTTCCAGACTGGTGTAGTAATGGTGCAGGATGTCTTGGCGTAGCGTCTCCGGTGCAACCAGCCTCATCATTCCGTGGCGATCGGCTTCGG
ATCGCTTGGTAGGCGGGCAGTAGAACAGCAGATCCTGGCTATCCACTTCATAGTCAGCCGCAATATTGCCGAGAGATCTagcttcatcttccgtcAGATT
CACCACATCTCCTGCCAAGTATTTCTTCATACTCGAGATCCACGCTTCATCATCCTGTGCCTTTCGCATCCGATCGATCCGCAGCCCACAGACAAACCCT
TCCTGCGTGACCGTTGGGTTTGATCTGGATCGAGCACCGGACCGAGTAGCCACTGGTGAGGTCCGGACGACTGGATCATTGGATCCGACTACCAGAATTT
CGTCGAGTCGATTCAACGTGATCAGGTCTTGACGACCTGCTTCACTCTCAACGTCGAGCCCTCCCTGACGTTGGAGAGCTGCGCTCGCCAGGCTATTCGC
GCTACCATTTCAGTCACGTTTAACATGTAGCAGCTCGTGATCTGGCCAGATCCGCAGCAGGTCTAAAGCCTTCTGCTTTAATAACGTTAGCCCGGGTGCC
TGGCAGTCGATCTCTCCTCTCACTTGCCGAATCACTAGGTTAGAGTCGCCACAGATCACTAGGCGCCCCGGATCCAAGCCTTCCAACCGTTCGACTCATA
GCAGTAAGCCATGATACTCCGCTTCATTGACTATAAGACCTTCGACATAGCTAGATCTGGCCTTCACCACGCTCCACTCAGGTAATTTCCATAGGGTCGC
TCCGAACGCACCTCCTACCCGCTTAGCGCGGGCGGATCCATCGAAGCTCACCACCAACATCTTTTCATCAGCCTTCACTGTCGGGATCGGCACCTGGATC
TGACGTCGAAGCTCCTTCCTCGGTGCGATCGCGACCAAAGCCTCGTCTACCTTGGATCTAGGCGTAATACTGGCGGCGATCGCCCCCAAAATCTCGTCTT
CTCCTTTCGTGCGATTCACGATCTCGAGGGTCCAAGGTGACAGGAGAGCTGCCCACTGACCTAGTTGGCCCTGGAGGTCGGGTGATCTGAATAGCCAGGC
CAGAGTTGAGTGCCGAGTAAGGATCCGGATCTGGCGCCCCACTAACATATTGTAGTTGAGATCTAGGATCCGCAGCAACGCTagcacttccttctccacc
acattTTAGTTCAACTCGTTTGATTTGAGCGTCCGACTGGTGAAGGTGACAGGACAGTAGATCCGATCGTGTTCTTGCATCAGGGCAACCGAGATCGCCC
AGTCACTGGCATACACGATCACCACTGGTAGTCGATCTGGATCGAAATGACGCagtcgccaccttcttcttcaacgctgTGAAAGACTTGTGGGCTCGGA
AACATCGTTCGTCCGCGACGTCGATGTCTGGCTGATCTGGATCCAGCGCCCCCAGTCCTGACGATGCTGGATTGGGTGGCACTTGATCTAGTTTCCCCAA
AATCTGACGCAGATCAGGACGTTTTCTCAGCTCGGCGAAGTCCACTTCTCGCAACTCGTATAGGATCGCCGCGTAGATCGCGTGGTCTTCTATGAAGCGG
CCGTAATAATTTAAGCTGCCCAGAAAAGACTGCATCGATCTGAGTGATCCAGGGAAAGGCAGATCCGTTAATGCCGACAGATCCTTGGGGTTAGCCTCTA
GACCTCCACTCGACACCCGATGTCCTAGATAGTCCACCTTGCGTAACCCCCAGAAGCTCTTTTCCACGCTGATCGACAGGTTCCACTTATCGCACGCTTC
CAGTAGATCTTCCACCCGATTGCATAGCTGATCCCAGGATCCGGCTGTCACTaggatgtcgtcgatgtagGATCTGCGTCCTAGCACCGATGGGCGTCCT
GGATCCTCCGGTTCTCCATCCTCAAACAGATCCACTATGCCTTTATAATTCTCTGATCGCGGGATCCGCATAAATCCGTACAGTGCGTTATCCAGGAGCC
GTTGGTAGATCTGGGGTGCGTTCTTGAGGCCGAATGGCATTCGATTCCACTCGAACAGGTCGAACGGAGTAATGAACGCCGAGATCGCACGAGCTCGATC
GGTCATCGGCACCACCCAAAACCCGCTCGCCATATCGAGAGAGCAGTACCACAATACCTTGTCCAGATCCTCGAGCAGATCGTTGATCAGTGGCATCGGG
TAGATCGTCAGCCGAGTTAGACCGTTAACCAATCGATAGTCAATACATAATCGTATATCCAcaccgttcttcttgatgatgatCACGATCGGTGACGCCC
ATGGGGACGTCGAGTGGTTGATGATCTTGGTCGATAATAAACCCTTGATCAGGTCTGACACTTTCTCTCAGAATCGTGGTGTCACTTTCCACACTCGCTG
CGCGATCGACCTTGCGTCTCCTACATCGATGTTGCACATAACACCTCGGGCTGCCGGTGGCAGTGCATTGCCCTTGCCGATCAAGAGGTGTCTCCTCCGT
CAGATCTTCTTACGCAGTCGATCGATCTCCACCGGGGTATTGAACTCCAGATCGCCTATCTTGATATCTTCGATCGTCACCTCGTCTGTCGTGGAGATGA
GAACTTCCGGAAGCACTGCCAACTCGCCTTCGATGTCTTCCGCCATCAGCTCACCACCCTTATGGTAGTGGATCTGGTCATCATCG