Description :
From Genome Similarity Track
Location :
Scaffold_4268:135- 1337
Sequence
1202 bases(100 bases per row)
CATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGATCCTGGGGTAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTA
ACGGGTCGGCCGAGCGCATGGTGCAGACGATCACGAGAGCACTCAAGATGTATGTCTAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGACT
CCCCTTCGCGATAAACACCGCCCAAGACAGGATCCGGGGTGATACCCCATTTAACTTGGTACATGGGTGGGATCCCAAATCCACCCTGGAAGTGGCCATC
CCAGTATGCAGCACCAAGAAGAGAAACCGAGATCCAAGACGATTGCGATACCAAGTCCAGAAATACTACCGGCAAGCCAGATCCCAAGTGAACGAACGGC
TGCGGAGTGCGATACAGGATCGGGCGAATCGACACAACGAAGACGTCCGTCCCCATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGT
GAAAGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCATGGACCGTTCCGGGTGAGCGAGAAGATTGGAGAACATGCGGTAAAGCTGAAAACGGCAGGT
ACCGAATATCGCATGCTCCCTGTAGTACACGTATCCAAGCTGAAGTTGGTCAAAGAATATCCGGATCGGCCGCAGATCCGTCTTTCGGTGGATGGATCCG
ACCGCGTCGACTTCGACGAAGTCCTCCTACCGGAAGATAGTTGGAATGTGGATCTCGAAGCCGACGAGTTCGAAGTCGAGAAGATCACCGATATGAGGTC
GGGGAAGCGAACTAGATACGGACGGATTTACCGTGAATTTCTGGTGTATTGGCGTGGATATGACGAACCCAGTTGGGTAGACGAGGCAGATCTGAACTGT
GGAGCATTACTCTATGATTTCTTGAGGGATCGTACGAATCGTAACAGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGGGAGGGGACCCATAGATGT
GAGCTGGTCATGTCGATGGGAGGATGAAGAAGGGCCCACAGGAAGGGTGTGGGCCAGGAGGAGGAGGATCGCTGATGTGAGTGGTCACATCGGAAAGAAA
GAGAAGACGAATCCACAGGGGAAGGGTGGATTAGGAGGAAGGAGTGAATGTTTATGCATAAGAGTGACGTTTTACGTGTGAGGAGTCCTGCTTGATCTCA
AG