Description :
From Genome Similarity Track
Location :
Scaffold_24:1349888- 1352202
Sequence
2314 bases(100 bases per row)
CGAAGGCTCCCCGGCCACCAGTAGAGGTAGTATGCCCTACTGAAGAGCGCTAAGCCTTCGTGATGGGTGTGCAGGTTGTGCGCACCACGGGACTTAGCCC
AGAGAGACGTTGTTCTCTCAAACCGGTGAAGGGTAGTGATGGGCTGCTGGTAGTACACTCGGTGTACGGGGGTACGGTACCCCTTGACCGCTTGATGAGT
TCGGGAACGTTGATACGCCGCCGGAACGTCGCTTGACATAGCGACACCCGACTGCACTTTATGTCAGAGTGGCGGTCGTGGGCTGATCCTTGGCTGACTA
GCCTTTGGTACGGTGAAGGAAGTACCAATGGTCCTGAACGGACCGGAACGTTTGGGCTCGATGAACCCACGCACATCGGTGTCGCTCGCAGCTCTCGCCA
TGAACAACATGGCTGTGCTTAACATAAGGCACAGCTCGGACTTTGGTGTGGCAAGGCTGAGAAGGGCCTACCAGTCCAGGTCTATGGCGGAGCATTGGTG
AGTCATGTTCCCACCTCCGTCATGACTGGGGCTTCTGATACAGACTGCCAGGACGCAGAAGCGCCACGGAGCTGTCAACGCGCTGCCAGCACTGCGTACA
GCAAGACCATGCTCCGCTGCGGCAATGCTACGGGCATGGGTATTTTGCCTGGCGTGTGGACCTGCTACACCAGCAGCGTCCAGCGCCGATGGTCGTCGCG
CCGTACGGGCTTCGACAGTAGTTATGCCTTTAAGCGCTAGCCAGGTGGGTAACTTAGAACCACATGGTCGCCCAGACCTTAACTGAAGAGGAATGCATGA
CCTTGCTTCCTGTGTGGCTAGCACAGTACCACACGCAGTCGCCCAGACTATAACGGAAGAGGAAGGCATTAACCATGCTTCCAACGTGGGTAACACAGTG
CCACACGAGGTCTCGAGTGCCTCTGATGTTGTCAACGAGACATCACGACGTGGGTAAAAAAGTGCCACGTCATGTCAGCCGTCGCAAGTCGGGTCTGAAC
ATTTTTCAGGCCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGACTCCTCTGACTCGGTCGGTGGACACCAACTCTGTACGGTGTGTGTGCGGGT
CTGCCACGTCAGCTGATCCCAACACCGAAGGTCGTCGCGCCGTATGCGCTTCGACAGTGGTGGTGCCGAAGGGCATTCACCAGGTGCGTATCATAGGTCC
ACATGCGGGTAACAAGATCCGCAAGCAGTGAAGCTGCTTAAGGAGCCCGACATTTGGTGCTCCGAGCGTGGGTAACAAAGCTCCACGCAAGGTCACTCAG
ACCATAACTGATAAGGAAGTCGCTGTATGCGCTTCCGGTGTGGGTAACAGAGTTCCATCCCAAAGGCGGGTAGCGTAGCTCCGCACACAGAGCCATTGGC
TCGAGGCGCGAGGTTGTCTTGACCTCGCCAGACGTGATCAACTCGCTCGACGTCAAGTCGTGCAGACCCAAGCTGCTGACGCGAAGGCTGGATGCCTTCG
GTCGGCACGGCCGACGCGGTCGCCCATACAGACGCAATGCACGGCGGAGAGCTGTCGTGCCTGACAGTGGCTACCAGAAGCCACGGGAGACTCAATAGTC
TCGAGGCTAAGTGGGCAAGAGGCTCGGAAATACCTTTCCGCCCTGACTTTCCACGAGGCAGGTAGCCGTTGTGCTGCCAGTGGCTATCACAAGCCACGGG
AGACTCAATGGTCTCAAGTGTAAGTGTAGGAGAGGCTCGGAAATACCTCTCCTCCCTGGTCTTGAGGTAAGCCCAAGTTCCTTACGGAACCAGGCGTCGA
TGTACATCGACTGCAGGATGGAGGCGAACAGCCGGGCTAGAGCTGCGGTAGCACTAGCCGAACAAGACATAGTGGCGAAGAAAGCCACTAGCGCAAGGTG
CCTCGGAATCGCTGAGCGAAACAGTAGTGTTGGGGTTGCAAGCAACCCCACACGAGGCGAAGCGCGGACCTAGTGCAATCACCGCACTGGTCCCTTGGTC
GTGAACGACCTGCCGAGTAGGGTGAACGGGACGTCTCACCCGCCGACAAAGCGGTTGCCGTACATCATGTACGCAACGCGTCGGGTATAATGGGCCGTGA
AGCCTTAACCCAAGTGTGGTGCACGAGTGCACACACAACAGACCAGGTGGTGGTCGAGGCAACGCACGCAGTCGTAACTGGTGCCGCGCCGAGCATGACA
CCGTGGTGATGGCTGCTTGCCTCACCACGGTTTGGTACCCGTGCGTACTCGGTGTCAATGCCAGACATTAACGCCGCAGTGGCATGGTGGTGAGATACGC
CCCACCACGGTTGA