Description :
From Genome Similarity Track
Location :
Scaffold_71:134983- 140187
Transcript NameFunction/comments
Physo_139190reverse transcriptase

Sequence
5204 bases(100 bases per row)
AAGCTAAAGTAGTGAGCCAAAGTAGGCCCATTACACCTCGTAGCACTTTGTAGTCCGTCCAACGACCGACTACCTGAACGTTCGTACGGAGCTGTACGGA
CGAGGAGTCGAGAACCTTTTCATGAGCACGGAGGTGCCCATCGAAAGCTCCACCTCGCCTGCAACTCATGTTGCACGCGCTGACTGCCTCTACCTGTCGG
ATCCAGAGTGGGAGGCACTCCAACGACTGTCAACAGTCATTGGGGAGGCGGCAGTAGCTGCGATGCTGCGTACGCTATCGCCGACAGAGCAACACTATGT
TGCTCTGGGGTTCATCATGAAGGAGCCGCGTGATGCTGCTTCCTCTACCACGGAGGCGTCGGAGACGACACCGCGTGGACAATCGTTGAAGCTAAACGTG
AGTAACTACGTCGGAAGAGAGGGCGAGCTTCTCTTCCGTTGGCTTGTCGAACTCGACACTGCCATTGCGGCTCGACGTGTCGTCGACCCGTTGTCCAAGG
TTGCGTTCGCCATGTCATGCCTTGGCGGACGAGCGAGAAGTTGGGCGTATGGACGCCGACTCTCGGATCCTACGTGCTTTAGCACGTACGAGGGTTTCAA
GGAAGAGCTCAGACAAGCGTTTGAGCCACCGCAAAACGAGTTCCGGTCGAGGGCGGAGTTCCTCGACCTGCAGCAGGGTAGGCATGATGTCCATGCTTAC
GCGCAAAGAGCACGGTACTTGGTCTCGAACATTGTGACCAACCCGATAGACGAGGCGACCAAGGTCGTCACGTTCATAAAGGGTCTGAGAGATGGGCCTT
TAAAGACCTATCTATTCCGTGAGTACCCAGGTACTCTCGAAGCTGCGATTACTCTTGCGATGCAGGAGGAGTTTAGTCTGAGGCAGGCTAAACTACATGC
GAATGCGCTGAGGCTGCAACCGCCTCCGGTCGCGATAGCGGGAGGTCCGGAACCAATGGACCTCTCGAATGCAACGGCTGTTGGTTATCAACAGCAACAA
GGAAGTAATGTACGATGCTTCTGTTGCGGAAGGATCGGTCACTATGTCCGAGAGTGCACGGCACCCGTGCACCGAGATGGTGGTCGACCCGGCGATGCCG
GGCATCGTCGCGGACAAACAATAAACGCTGGAACCCAGTAGGCGCGGGGCGCCCTACTGGTAATGCAGTTCCGCGTGTCGACCTTGGACACGCGACACTG
AGGACGGCAGCCCCCAGTGAGGTTCATCATCACTGCAAGAACCAAGATTACAAGCCTGACCTTGTCATCCTGAATGTGAACTTGATGAGAGCAAGCGGCT
CTCTCCGTGCTTTGGTAGATTATGGCGCGTCGAAGAACTTTGTTCGACTGCGAAGTCTATCAAGGCTTGACTTCGAGGATTTAAAGATATCTCGAAGTAT
GTTGGAAGTACGACTGGCAACGGGTGCCGTCGTGAAGACCGAGAAGCGCATGGTACGCGTGCGCTTCACGTATGAAGATCAAGAGTTTGTCGAGACCTTT
ATCGTCCTGGATCTGGACGATAAGTTTGGCATTGTATTGGGCATGCCGTGGCTTGCACGGCATGATCTGGTCATCGATTGGGAGAAGCGCACTCTCGTGC
GCTTCGGTCGCGACAGCGGAACAGTGAGCGATGGCCCTGTTGCCGCTACGCACGCACCGACAGGTGCGCGCGACTCCCCACTCGAGACAGCGCCTAATGC
CGCTGTCCCGGAGCGCCCTGGGCGCGCGCGAGCACGCGCGCAAGAGCAGCTAGCGTCGGCGTTGCCGCCAACAGCTAATGAAGGAAATGTGTTGACCTCG
GAGGTCGACACCCGCTTTTCAGCGAATCAGGAAGAGTCTCCGGCCTCAAGGGGCACGGATGACGCAGGCGAGTCACACGCCTCAGCCGTGGAGGCTGACG
CGAATCTGATTGGATCAGGTCTGGCCATTAATAAGAGCCAAGGTGACGTAACGCCGTCGACTCCGGGAGTCGATGGCTTTCGACTCCGGGAGTCGATGGC
TTGGGTGAATTTGATTCATCGGCTCGGGGAGCCGACGTATCATCCGTAACGGAGGGCTCCGCCAATAACAGGCGTCGAGGTGAAGATGGCGTGTCGGCTC
CGGGAGTCGACGCTGCAAGTGGTGCGGACGATTGCAAACGTCCCGCACCGGAAAAACTTGCATGCTGTCGTGCAGCACTGCTGCACGACGAAGCGCCGGG
CGACCAAGCCGGGCTTGAAGTCGCCCGCCCGCGGGATAAACCCGCCGGGGGTACTGAAGACGAACACCCGTCCACGGCTGAGCCTGGACGAGGTCAAGAA
CCAAGCGGAGCCGGGCTCCGCAAAACAAGAAGACGGCGCATGCGAAGGTCGCTGCGCAAGTCTCGGCCTGGGGCCGAGACGCTACAAGGAATGTGTGCCG
GGCAGACGGAGGCGGAGAAGCCGGACGTCGAGACGTTGAACGTCTTGACGCGTACCTGTGCCGGGTTCCGGTACAGGGAGATGACTCTCGCTAACCCTCC
GACGCAAGCGTCGGAGTTGACTTCGCTTCCAGTCATGAGCTGGAAACGCTTCGCGCGTGACTTGTACGATGGACGCATCGAGCAAATATGCATTCTCTCG
GACGCCGAGAGAACGAAGAGCGAGAATGAAAAACTCAGGCAGTTCTTCATGGAGACCACCACTGAGAGCGAGGACACTCTCAGTGCGAAGACGAAGAAGG
AGCGCTTTGAAGAGCAGAGCTGGGACTCGTTTTCAACGAGTCCCTACTACGAGATCTTACGGGAGTACGCGGACGTACTTCCGGAAGAGATTCCTGCGGA
GCTTCCGCATGATAAGGGCATCCAGCACGAGATTGATCTCGTGCCGGGGATGAAGTACTGTGTCACGCGGCAGTGGCCACGACCGCGAGAGCAGGTCAAG
GCGATCGACGACTTCTTTGAGAGTCGTCGTAAAGCTGGACAAGTGCGGGAATCGAAATCCCCGCACAGTGCTCCGACGTTCTGTGTCAAGAAGCCACAGG
GCGGTTGGCGCATCGCTCATGCGTATAACAAGCTGAACGATGCGACGATACCGGCGAAGACGCCGATACCTCGAAAAGATGTTATCATCGATTCGATGGC
CAGGAGCACTATCTACAGTGCTCTTGATCTGCGCGATGGGTTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCACGGCTGTGAGCACGCCGAGC
GGCATGTTCTGGGAGTGGCTAGTGATGCCGCAGGGTCTGAAGAACGCCCCTGCGACCTTCAACAGGTGCGTGGCGCACTTGTTGCGCGACTTCGGACCGA
GCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACGGGATGAGCGATGTTGAGATGCACAAGGTGCATCTCCGGAAGCTGCTTGCGCTCATGCG
CAAGCACAAGCTCTATGCGAACCTGAAGAAGTGTATCTTCGGGACGAGCGAGATACCCGTGCTCGGGTGTCTCGTTGGGAAGAACGGTGCCCGCCCTGGA
CCTGAGAAGGTCAGAGTGATCAATGAGTGGCCGACGCCGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGA
AGGACTACGCGGGCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACGCCGAGTTTGGACTGCTGAGTGCCAGCAGGCCTTCGATGCAGTCAAGCGG
GGCTTGACTGAGGCACCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTATGTGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGC
AGCACGATCACGAGGGTCGTGATCGTGTCGTCTACTACCAATCGTGTCAGCTGAAGTCAGCTGAGCGCAACTACCCGGTACATGACCAGGAGCTCCTTGC
CATGAAGTACGCACTCGCGAAGTTCGGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTATACGCACCACGCGTCGTTGCGGACGGCTGTGAAGTCG
CCGCACATCTCGCAACGGATGGCGAGATGGCTCTCACTCTTTGCAGAGTATAACTTCCGGGTTGAGTACAAACCCGGAAGACTCAATGTGGTGGCCGACG
CGTTCTCGCGTCGACCTGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGCCATGCGATCGAGCACCCCGACGTCGTCACTGCTGGACGACGT
GAAGGTCGCGTACGCGTCGTGCGCGTACGCGAAGCTCTTGCTGGCCTACGGCTCAGCGCCTTCTGACTAAGCTCGTCAGAAGCTGCCGAAGCATCTTCGT
GCTCGTGCACACCGTTACCGGGTGCACGACGGGTTATTACTCTACAGTGCAGTCGACGACAACGCCGTCCGCGTTGTCGTGCCCAATGACCATGACCTGC
GACTCAGAATCATGTATGAGTATCACGATGCACCGACTGCGGGGCATCCGGGCCGTGAGAAGACATACCTTCTTCTCACGCGAGACTTCTACTGGGCCCA
CCAGTATAAATGGGTGCGCAAGTACGTCCGTGTTTGCGAGGTTTGTCAACGTGTGAAGTCTGCGCCTTTCGCGCAGGCTCCCTTGCAGTCACTACCAACT
CCACGGGAGTGTTGGCAGTCCATGTCTTTGGACTTCGTGTTCGGTCTTCCCCCGGACAGCCAGGGGAACACGGGCGTTGTGGTCTTTGTTGACCGCTTCA
GCAAGATGGTACATCTTGCTGCAGTACCCGCTGAAGTGACTGCGAAGCAGACGGCGCGTCTGTTCGTTGACATGGTGTTCAAACACGATCGACATTCTGT
CGGATCGGGACCCGCGCTTCACTGCACACCTTTGGCAAGAAGTGTTTACACTTCTTGGGAGTCAACTTTCGATGTCGACTGCGGACCATCCGCAGACGGA
CGGGCAGACCAAGCGCGCGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTACGCTCACTCGTTCCAACACTGGAACGAGTGCCTGCCCGATGGCGGAGTT
CGCCATTAACAACTCGGTGCATGCCTCGACCGGGCATACACCGTTCTACGTGAATACCGTCAGGCACCCACGCCTCCCGAGTCTACTCGGGATGGTGGCT
CCTTCCTTAAGTGGGGGGGGATCTACGACTGCAACGCAGCAGCCGCAGAATCAACGCAGCAGCCGCAGAATGCCGCTGACACTTGCACAGTGTCAGCCGC
GACT