Description :
From Genome Similarity Track
Location :
Scaffold_429:13495- 14943
Transcript NameFunction/comments
Phyag_g5636nucleolar protein Nop56

Sequence
1448 bases(100 bases per row)
gcttcctcctttttctgcttcttgttcttcttgtctttcttggatttcttggcgggggcctcctcctcgacctcctccatctcagcatcctcctcctcag
ccgGACGCTTCTTAgacttcttgtccttcttaGACTTCTTGTCAGACTTGGTAgcagccttcttgagctcctctGAGACCTCCAGCATCACGTCAGCGTT
CTTACGCGGGGCAGCGCCGCTCTCGTAGAAGGCAAGACGCTCCTCAACCTGCTCACGCATCTTGTCGCCGTACTTGGTTGTGGGCTCGTCAATGAACGAG
TCAATACGCGAGGCAATGGCACACTTGTTGGCAAGGTAACGCGAGATGCGGCCCTTgttcttggcagcagcgcggcCAATGAAGGTCGAGTGGAACAGCA
GACCGTACTTGGGCGTGTTGCCGCGGGTCTTCAGAGCGCGGAACAGAGCCTTCTCGGCGCCGAGAATCTGCACCGTAGAGGCCGGGCACTTGGCCAGGTT
GGTCAGCGAACCAGCGTGCGAGATGAGGCGAGCACCCACCGACTCGCCAATAAGAGAGGCAAGGTTGGGGGCCACCGTCGACATCTTGGACACCAGGTAT
TCGTGCAGCTGACGACGGTACTCGGCGAGCTTGACGAGGCGCGTGGTGAAGTTGTCCACGTTGATCATATCGATCTCCGACATGTCCATGCCCATAGAAG
AGCGGGCGGCGTGCAGGATCTGCTGGGccttgtcctcgtccagcacaatcttggccagctcctcgagcttgtcctcGCTCAGCGTGTTGCGGTTCTTAAT
GAACGAGGCGCAGCGCGCGTACACGTAGTTGTCGTTGACGATTTTGACCAGCTCCGGGAAGTGCCACGAGTACCACTCGCGCACACGCATGGCGAACGTG
TTGATGTCCTTGTCCATCTGGTCGAGCAGGGCAATGGCCTGGATGATCATGTTGTCGGCACGGTTCACGTTGAATTTCACCTTGGCACGCGAGTACGAGT
GGCCGAGACCGAGCTGGGCCTTGGCCAGGTTGCCCTGggccagctccttgacgaACGTGCTGAAGTGCATGCGCACGCCGCGCACGATCTCGAGCGTCGT
CTCACTCGTGTTGCACGGGGCGTTGAGCTCGTCCGAGATGGCCTGGGCCAGGCCCTTGTCCTGCACGCCCAGAGCgaacttggccttcttgccggACTTG
ACCTTGGGCAGGTTCATCTCCAGGAAGTTCTTGAGGTCGTCGCCCAGCAGTCCTTCCGACACGTTGTTAATGTTCTCGAGGGCGTTCTCGGCCGACGTGA
AGGGCTGGAAAGCCTTGAGCTTTACGATGCGACCGAACGACGACACGTCGGCCACGGCGGCCTGCACCTCGCTCAGCAATGAGCCGATCTCctcgttctc
caccacctcaaAGATTGCATAGCCCGAGGCCGactcgaacagcacgaa