Description :
From Genome Similarity Track
Location :
Scaffold_554:13492- 15144
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_554-snap-gene-0.14Callose synthase

Sequence
1652 bases(100 bases per row)
GTGGCTGCTCGCGTAGAACCGGTAGAGCTCGTCAAAGCGCGAGTGCTTGGTCACGAAGCCTCGGCCCGTGGCACGGTACTTGGCGCCACCAGCGAGGATC
GTTTGTCCGTAGTAGAACCACTTGGTACCGATGTGGAACAAAAAGTAGAGCGGACCGCCCGTCACAAAGATCATAAACACTTCCTTCAGCGCAGCCTTGA
ACCCGCGCTCGACCGAGATCGTCGCGAGCAGTGGCGCCGTCGTGAAGAATGCGACCGAGCCCAGCATCATCTGCAGTTGGCTCAACAGCACAGGCGTGCG
ACCACCAACACCCTCGAGGGACAGCAGCGCGCGCAGCAGGTTGCAGTACAGCAAGATGTACACGGTCCAGATGATCATCGACATGGACAAGTAGAAGCCC
ACGTGGTTGTAGTAGAACGAGAGCAGCTTGAAGAAGTCAAGGCGCTGACTGATGCGGTACACGTCACGCGAGAGCGATTGCTCGGCCGCACCCTGCGCGA
GCTTGGCCTCAAACTTGTAGATCTGCTGCATGCCGACATCACGGCCCTTGCCGCACTTGACGTACTCGGGGAACGTCACCGAGCCGCCACGGAGACAGTT
GTTGTAGCCCGCAAAAATATCCTCACTGAGGTTGATGCCCTTGCTGGCCTTGCTGATACCACCGCGCGTGATGAAGAAGAGCTTGTTGAACACATCCGGA
TGGCCGTAGTGGAGGCGCACACGCAGTGGACGCGCGAGCGTACGCTGACCCAGCGTCACGAACGACGTCTCCTGCAGTGCCATGTAGTTCGCCAGCGAAC
TCACGCTGCCCGTGAAAATGTGCTCTGGAAGACCAACAATTGTGTACGGACGGTCAGGCGTGCCCGAGTCAAACTCTTCGAGCATGTTGCGCATCTTGAG
CGATTCCTCAATGTATCCGTCTTGGTTCATATCGATCGTCTGCAGGTTCTCACCACGCGTGAACACGATCGCAGCATTCTGGTTCTCGGGCTTGCCCTCG
CCGAGGATCGGGTTGCCTGGCAACCGCACGCGGTACACTTCCTCGACCGTGCCCAACGACTCACTGCCCTTGACGAGCACCGTGAAGTACGACTGCTCCT
TCTGGTAGTTTACGCGCACTTCGTCAATGTACGAGACGCGGAGGTTCGGGAACCGGTGCAGCAGGAAATCAATGTCGCGCGCCTTCGGGTCGTTGTTGCG
CTTCTGGCGACCGTAGATCTGGCATGCGACCACGTACGTGAACTTGGTCTTGATGAGCTCTTCGATGCGCTCGACAGGCACTTGTTCAATCTCAGCCAGC
AAGCGGATCGCAGCCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGTCTGGCCACGTAACGATGCCCACAGACGCAACTCA
ATCGCCGTGTGCGGATCCTTCCAAAAATTCTTCTTCGGCTTGACACGCTCCAAAAAGTTCTCCCAGTCCTGCTTGTACAGAGTCTGCAAGAACAGCAGCG
TGTGCACATCGAGACCGTCCTGCTTGCTCTCCAAGTCCGACTTGGAGTACAAAACGTCTTCACCGTAGAACGGCGTCATGACGCTCCACGACTTCATTTC
CTCCAGCAACGGCGCCAGCGGCATGTCCATGAACAGCGAGTTGACAAAGAAG