Description :
From Genome Similarity Track
Location :
Scaffold_58:134915- 137879
Sequence
2964 bases(100 bases per row)
CAGCTCGTCGATGAATCCTAGATGAGAAGACTTAGATGGAACGATGTACGTCCCAATCTTGGGAGTCGCTTCAGTCATATCGTTTGTATATGGACTTGAT
CGGATTCAAGGATGTTTTCCCTGAATCCGTACCATACGAGTTGCCTAAGGATACAGGCAATCGATACGAAATCGAGATCAAACCGGGCTCAAATACTGTA
GCATGAAGCAGTGGCCACTGCCTCGTGAAAAAGTACTATCTATCGAAACGTTCTTTGAAGATCGATTAGCAGCCGGCCACGTGAGGAAGTCGACATCCTC
ACATAGCTCTCCGACCTTCTGTGTGCAAAAAGACACAGAAGGATGGCAGGTAGTGCATGCATTTAACAAACTGAATGCTGCAATGGTACCGGCTCAGACG
CCGATACCGAGGAAAGGTGTTATTATAGACTGTATGGCAAAGATTACCATCTTTTCGTCCATACATCTGATGGATCGTTTTAATATATCCTTATGAGTGA
AGGGGACATCCCGTAAACAACCGTGAGCGCCCCCTGTGGTATGCCCCGGTAGTGGCTAGTAATGCCACAAGGGCTAAGTAACGCTCCCTTCCATTCAACA
GATGTGTTACAGATCTGTTGAGACCGGTGCGAGATTTCGCACCAAGTTACTTTGAAGATTTATTTATCCATATCCGGGATTTTGGGAAGAAAGACGGACG
TGGAAGTCATAGAGCGCACACGCGCCATATTCTTACACTTATGCTTGCGCATAAGCTGTACGCCAAACCTAAAAAGTTTATATTTGCTGCGATCGAGGAA
CATCTTCTTAGGTGCATCGTGGGTAAACACAGCGTACTCCCTGATCCAGAAAAAATCAAGGCGATTACCGACTGGCATGTGTTAGTCGACGTCAAGGGAC
TTAAAAAGCTCCTTAGGCTAGTGGCATACTTGCGCAAGGACTCGCGCAACTACGCCAAGATGACCGTTCATCTCTCTTGTCTCTTGAACATGAACGAGAA
GTGATCATGGAACGCTAAATGTCAGTGTTCTTTGGAGGGTTTCAAGTAAAGCTTGATGCAATCGCCCACGTTAGCAATTGCAGATCAGGACATAACATTC
CATGTGGTCTGTGACGCCAGCGATTTTGCAATCGGCTGTGCGTTAATGCAGTACTATACAGACAGCGCAGATAACCCGATGCATGACAAGGAACTCCTTG
CCATAAACTATGCACTGGCTAAGCTCCGCGTCTATCTCCTAGTAGATAGACCTTTCGTCGTGTATACGGACTATGCGTCATTACGCACGGCCGTAAACAG
TACCTATTTCTGACAAGGAATGGAGAGACGGCTATCCTTCTTCGCGGAGTACAACTTCTCTGTGTAGTATAAGCCAGGACGGCTAAATGTCGTCACTGAT
GCGTTATCGCGCCGACCCTACTTCGAGTCGGCTACACAGTTTAACAGTGAAGGTGAGTCTACTGTCACAACACTAGCTGTAAGTGGCCCGTCATCACCAT
TGCGTGACGACGTAAAGAAGGCCTACGAAGAAGATAAGGATTCTTTTCATCTCATAAATCTCTTAAAGAATTACAACAATCGTTGCTGGCTACACACCTC
GTGTCATCATTCCCACTAACAATGAATTGCACTTGCGCATCATTTATGAGTGTCACAATGCACAAATAAGTGTTCAGTATGGGAATAAAAACCTATCTTA
CGGTACGCCGCTACTTTTACTGGCCTCGCCAGCATAAGCTCTTGCGCAAGTGCATTCGTGCTTGCGCGGTGATTCAACGTGTGAAGCATATTCCTTCATC
CCGTGCCCAACTACAGTCTATACCGGTACCAGCATAGTGCTGGCAGTCGTTTCCATGGACTTCGTCTTTGGATTCCCCGAAGAGTCTCACAAAAAAATGG
TATTCTTGTGTTCGTTAACCGATTCAGCAAGATGTACCATCTTGCTGCAGTTCAAGATTCGATCACAACACAGAAATGTGCCCGTGTCTTCATCGACACG
ATCTTCGACTCCACTGTCTACCACGTGGGCTACTCTCTGAAAGAAATTCATGGTTTACGGCAGCGTTTTGGCAATTCATGTTCCGACCACTCGGGACACG
TCTAACTATGTCAACATCTGACCATCCAGAGACAGATGGTCAGATGGAACGCGTCAACCGCGTCCTCGAAGAGATACTTTGTGGGTATGTCCAATTGTTC
ACGAGTAGGAGGGAAATATTGCCTATGGTTGAGTTCGCCATCAGCAACTCGGTGCACGCTTCAACAACACATACACCATTCTTCGTGGATGGCTTCCGCC
ATCCACGTTAAGCCGCTCGATTAAAGAGTAACCCTAGTTCAAGGGGGGTGGACTCGCTTGAGCAAAATCCGTTATAGCTCTTGCGCATCCCACGTCGACG
CAATCAACGACGCGAACGATGTCAATTTCCATGTAATCGACATCGAAGAAGGCAACTTCAGCAATAGTGAGGAAACTACTTCTGACTCAGATAATGATGA
CAATGCTGGTCTACTCAGCAATTCCAATGACGACACGAGTGAGCATGAAGACAGCCTTGCTGAAGAAGAGAATGATCTCTTAGCAGTGCACACTAGGCGC
ACTGAAACAAACAAAGGCGAGTCAGCAGAAGAAATTATGCTGGCACGAGAATCAGTGGTCTGTTCTTGCAGAAATCCATTGCTAACGCGGTGGAACAGCA
AAAAGGGAACGCTGATAAGAATGGAAGATCAAATGATCTTCTTTTTAATATACGGAGACTTAGTACTACTGTCTACAGCATATATAACTAAACATTGAGT
TTCTAATGTGAGTAGTAGTAAACTACTACTTTAGTACATCAGCCCGTTTCTTGTACTAAATCGCAAAGGCAATGTGTGCACAATAGAGTTGCCTCGTAAG
ATGCGCACGCATTTTACGTTCTTATGTGGGGCGGCTCCGCCCGTAGTATCAGCACGCGTCATCT