Description :
From Genome Similarity Track
Location :
Scaffold_662:13491- 15505
Sequence
2014 bases(100 bases per row)
TGAGCATCTTTAACGGTCTGCGCCCTGTCCCAGACGGTGAACGTGCCTTCCAAGGGTCGCTGAGTCTTCCGCGAACTCATCCCAACCGCCGCTGAGGGTT
CGTACCGTAGATGGTCCGCTGAATGCGAATCCGGCCAGTCCATTATTAATAATAAGGACAGCCTGGATTCAGTGACATATGGCCGTATCCAATACTTGTG
GTAAAGTGCTTTCTCAGAAATAAGAGAATGGGCCTGACGCGGGGTCACTATCCCGAATCAGTGACAATTTCAAGTGATTAGAGAGGATTTGGGTTGGCTG
GCACGGATGCAAGTTGCCTGTGGTGGATTAGCCATGGCGAGCAGCACCCCGTATGAAATGACGATGGATCTGGTATGAGCGATGTACGAGAAGGCAAGAT
CCACCAAGACTTATCTCGGATCCACCCTTACCTGGATCCACTTGGGTGGATATGGGATACGCTATGTACGGGTGGATCGAGTGTGGATCCTATGAAGGAA
TGGTGGTAGGTGCCCTCTGAAGGTGGATCTAGTAGCCACGACTAATGAGGAGTCAAGATCCACCGCGATGTACCCCGGATCCCATACTTCCGAGTTCGGA
TCCAAGGAGGGAGGATCCCGCCTGGAGGGACCTGGATCCAGGGTATAGGGATGATGGATGCAGTGGATCTCGAACTTTCGTGGGACAATGGAGATCACAG
ACGGTTGCGAGATGATGTTGGATGATTGGAGAGCTCAGATCCACGACGAGTGTGCACTTACAGTGAAGTGGATCCAAGCGACCTGGATCCGGATGAGTGT
AGCCAAAAATAGAGTGACCGGGGGGGGGTACGTCATGGATCCGGTGGATCTGAAGATAACACAGCTGGGATGATGGGTCAAGGGAAGAAGGGACATGCAG
CCGAGCCTGGTAAGGGATTTAGCAGATGAAAGACATAGAAGGTAGAAATCCAGGCAGGTATAGGCTTAAGTATCAATACAGAACTCAATTTGCACAATAT
CACGCAAGTGCATACATGCCCTCAAGAACCGGAACTACATTTGGCCGTACGAGCTCGGAGAAGGTTGGGAATTGCAAATCTAGTGTGGGTAGTGATAACT
GGATAATACATTGGCCAGATCCTACAACCTAGTGAGCTTTTCCTTTACTTGTGCAGATCCGACAGGTTAACCGAATTTACTACTTGGTCGGTTACACCCT
AGAGGCTCTCGACTTTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACGCAAAGGAACTACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGC
CAGATCCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATTCGGAACAACCCGCGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCA
CCCCATCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGATCAAGATCCCGCCCTACCGACGGGTACACAAG
GTGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTT
TGCTGATCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCATGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGC
CAGGGGAAGAGGCGTCGTCGGAAGTCGGATCGACGAAGATGCTGCTGAACGAAACAAGATCCGCGGATCGATGGGGTTTTGGGAGGAACTCTGTCGACGG
AAGAGAGGTGGATCCGGATCCGGATCTAGAAGAAAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTCCGGATCTTGACGCAAGTCAAGATCCG
CTAACAAAACAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCATCGGTTAAGCCAACACCGTACCTAAACCCAAGCCCGCTAGTCGAAGAAA
CAAGAAAGAAGACG