Description :
From Genome Similarity Track
Location :
Scaffold_3:13490- 14789
Transcript NameFunction/comments
g18679.t1hypothetical protein

Sequence
1299 bases(100 bases per row)
TCGTATAGTAGAACACCACAGTTAAGCCTCGACACAGGTAACCACTCCGTTTCATCGTAGCCCTTCCATTTCACAAGGTATTCGCGAGAGCGCCTTGATG
TCCGAGTCCTCTTAGTCCAGCGCAAATCTAGGATTCGCTCGACTTCATACTCGTCATTCTCGACGTCAGATTCCCAGCTGTCTTCTGGTAGGAACGCTGC
GTCAAAGTCGTCATCTTCCTTCACGTCAATTTCCACAGCAGGTCGCTTTGGGAACAGTGTTCTAGGCTTTAGTCGACTCACATGCACCCAGGGGTTAACA
CGATATCCTGAGTTCTCAATCCTGAGTTTCACTCTGAAGTCGTCGTGCATTTCCTGGATACGGAATGGACCATGCCACATGTGAGCTAGTTTCCGGCTGA
GTCCGGGCTGCACCTTCGGTATATATAACCAGACAGCATCGCCCACAGCGAAGCCAGCTCTCAATCGTTCGGACAGTTCTTTCCACTTCCTGGTCTGCTC
AGCAGAACGCATGCGTTTAGCCTTCTTTTGCAGGTCTCTGGCACAAGCCTGAGCGTAGCTGTAATCACGCTGCAACTTCCGACGCCAGTCATACGCAGTG
CGTTCTTGGACGCTCGACGGCTTGGGTCCTGGCATAGCAGACACCGTACCGTGTGCATCCCAGCCGTGCACCAGGAAGAAAGGTGTATCCAGTCTCGTTG
CATCGAACGATGAATTGAGAGCAAACATCAGTCGTTCTGCATGATCATCCCAGTCACTCTGGTCGGCTTCCGCAACGTACGCGCGGATGCTTCGCACCAC
AGTCTGCACAGATCTCTCCTGCTGGCCGTTGACTTGAGGGCGATACGCCAGAGTGGCTCGCTGCTTGCTACCCAGGAGTTCCCGGAATCGCGTGAAGACC
TCACTCATGAATCTTGGATCCTGGTCATGTCTTATCATAGAACTCGCTCCGAACCTCCTGAATGCGCATTCTTCGTAGACTTCAGCGACATCTTGGGCCG
TCGTAGAACTCATGGGTTTACACATCACGAACCCTGAAAACATGTCCTGGAATAGGAGCAAAAGGTGTTTCCGCGGTCCGACTTAGGCATGTGCGTCACG
AAATCCATGGACACAACCTCGAACGGTCGTCTGGGCTCAATGCTTCCAGGCGAAGTTCCAGGATTTGGAGGACGCCCCTTGCCGCTGGCGCAATCTACGC
ATTCCTTGACGAATTTCTCAACATCGGCATACATACCGGACCAGTAGAATTCAGAGCGAAGCTGCTCATACGTCCGCGTGATCCCTTGGTATCCACCTT