Description :
From Genome Similarity Track
Location :
Scaffold_149:1349- 2362
Transcript NameFunction/comments
g7045.t1hypothetical protein

Sequence
1013 bases(100 bases per row)
CTGACATGGATCGACGCCCACCTGTAGGCGCGGCATCTGCGCAGTCCGCGTAAGAGCCCCAGTCGGACCGCTCGATAGGACGTCATTCGCCCGCCTCCAT
ACGTGGCGCTACTCGCGTACTGGAGGACGTATGCGCCCGTAGCCGGGTACACCTTCACCACTAGCGTGCCGCTGCAGCATCTTGTGGCATCGTCGCCCTT
GATCCCCGCTGTCGCTACTAGGAAGCAGTGACCCTGTCGCGGCAAACGGCCGTCTTGTCCGGTCCACTCGTTCCCAAGCACCGCACAGATAGCCTCGCAT
ATCTTGTTACTGATGGGCAGCGGTATCGCGGCCTCGAAATCTCTTGTCACGTCCCTATGACCATTGCGGATCCTAGTCGTCAGGCTTGCGGTGTGGTGCG
CTTCTGAAACATCGTTATGATTGTCAAAATGCGCAATCCTCCACCTCCACACCGCCAGAAAGTACAGTGCTGCCCCCAGAGTCCAGCAGTTGGCCACCAT
CCTCTCCACTGTGGCACCAATCGCCTCCCCCAGCTCATCATTCAGGTCCGCTATGATCGCCCCCGTTGCCGTCACTAAGCCTCGTGGTAACATAGGGAGC
TCCAGCCCAAAGATGGCCTTCTCATACGTCTCCTGTTTCAGCCCTGCAGATTCCCATCTAGTCACCAGTATCTGCCTCAGCTTCGTCGCCGCTGGGCATT
CCCAAAAAATATGGTACAGGTCTACCTTTCCACCTCGTGCACACCCGGCGTGTGGGCAGTATAGTCCCGTCGTGACCGGGTTGTAGGCCGAGACGGCGTT
TAGTTTGACCCTCAGGAGCAGCTGCTCTCCCCAAGGGTTCAGCCCCACCACTCGTCTGATTCTTGTCCACGTCAGCGCCTCGAGTCCTTTAACCACTTCA
TCGTTCAGCAGCTTCCATCGCCCCTGGCGTGCGTCTCGAAGCTGTCGTCCTTTGGTCACGTTCGCCGCCCCAATGAGAGACTTGTACGTCCTCCTCGATG
TCTTCCATTGCCG