Description :
From Genome Similarity Track
Location :
Scaffold_281:13489- 14970
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_281-fgenesh-gene-0.7Aspartyl protease family A01B

Sequence
1481 bases(100 bases per row)
CGTACCGCAGTTGGCTTCTGCAAACCCGACGCGCTTGCTATCGACGTCAAAGACCACGTCGTATCCGACCATCGTGCTGGCTCCGAGCACTACTCAAGGT
TAGAGAAAGCGAATACACAAACAGTTAGCATTTGATAACTCATCATGTCCAACCCCACCAAGCAAAAGCTCGAAACGTACCACCACCGCTGCGCTCCGTA
AAGTGGATGTTCCCATAGTAGTACTTGCCGTCGTCCGAGAGCGTCAAGTACTTCTGTGGCGGGATGTTCAGCTCAATGTCCTCGTCACCCTCCTTCATGC
CTTCGAGCACAATTGTGATGTTTGGCAAGTTCTTGAAATCGTCATCGTTGACGCTCATCTTGTTCTCGCTGTACGTGACTCCGGCCGCGCGCTCAAACTC
GCGCTGGAACGCTCGCGAGCCGCTCGCGACAAAGAACGTGTCGGTCGTACCGCTGTCTACGATCACGCCCTTGCCGCTGTTGAGCTCGGACGCCTTGATG
CCGAGCGTGTTCCCGCCCACCCAGATGTCTTTCACTTTCACTGGGTACCACCCCGAGTTGTCCATGATCAGCGGCGTGTACGACACGTCGGTCTTGTGGT
GCGTGTAGTCCACGCCACCAAGCACGAGGCTGCCGCCGTTTGCGCCAAAGCAGAGCGAGAACACGTTCTTCTCGACACGCTTGGCATTCACCATGTACGA
CAGGACGGTCGACTTGTCGCGCCCCATGCCCATGATGCCGTTCTCCTTCTGGGTGATGAAGAGCCCGGTCTCTTTCGTCTGACAGCCCAGAGGGAACCGC
ACACCGTAGTGGTGCATGATCAAGTCCGCGTCAGTACCAGAGAACCCGCCGACCCACACGAGCTCGTCCACAACCACCGCCTGCCACATGCTGCCTTCTG
TGTAGCTCTGTGTACAAGCATTAAGACGTTAGGAGGGACGATCAGCAACCAGAACCATTACCAACAGGTGCAACCACACAACTTCAAAAGAAGACAGACC
TGGCTAATGTAGCAGCGGTCTTCGCTGCACGTGTTGCACGCCGAGAATTCGCGGCACGTTGCGAACTTGGCGGTCGTTGACTTGGTGATATCGAAGAACG
CGTCTGTGTGCTCGCCACAGCCTTTGCATCTACAGGCGGTGAGTGGTTCATAAGCGCAGAACGTTCGTATTTCCCCATTAGAAACCCCAGCATAGTTACC
AATCGCAGCATATATGTGAACAAGAGAGTAATGATACAATACGTACGAGGAGCATGGAAGCGCGGTCAAGTGACTGCCGGTGTCCACGATCACGGACGCG
CGCTGCGCTGGCACCCCCAAGTAGATCTCGGCATAGTGCGTCCTGTCGTCCGCACACACATTCACACACAGTGCATCTCAGTCCAACGCGTCCCCTCATC
GCTATTCTCACACACATAACCGTATTCGCAGCGCATAAAGACGCTCACTCACCCAAAACCGACGCCGAGCGGCACCTCGCT