Description :
From Genome Similarity Track
Location :
Scaffold_271:13487- 18239
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_271-snap-gene-0.15Tubulin-specific chaperone D

Sequence
4752 bases(100 bases per row)
CTGCATTTTAGTAGCCCATCTCTTTGACAAGCGCCTGATAGCTCTCGACATTTTGTCCTTCCTCCCGCGCCGCCACAGGTTCCGCGCGTCTAGCAAACGA
CAAACGGCACAAGGGGAAAAAGTGTCAAAATTTGAAAGGGTTCCTTGCTGCAATGATAACGGCAGGTGGCTGGACTTACAGCCTCTTCTGGGGCCGGTCC
ATATCGAGGAGGTCCAGCAGTTGGTTCCGTGCCTCGCGAACCTGCGCCATCTAATCCATAAAACAACAACACAGCAGTCAGTTGAACACAAAACACTTGA
AGTCACAATCAGCACGAGCCCAGAATCAACAACTTACCGGCGCGTCCCACGCAGTCTCACTCAAGATCTCCACGACGGTGTCATACTACATGCAAGATGA
GTGTTGAGCGCATTGTCGAGGTTGAAAAGGGCATAGAGTCTCACATATGTATACATGCCGTACCTTGCTCTCGTCGATGATTTCTTCGTGCACGAGTAGT
CTCGTGTAGAGCTTCTCGGCCGTCAGTTTGCGTACTTTTGGGAACCGATGCGCCAGGAACAGCACGAGTGCCTTCAGCGCTTTCGTCTCAGTCTCGGGTT
CGCTCGGGAGCAACCCGGTTAGCACGGCGATCGCGGCGGCGAGTTTCGGGACCGACGTCGATTTCTGAATCTCGTCACGCAGCGCAGCGTACAGTTTGCC
GCCGAAATCCGTTTTCTGCGTGTTCTCATCACCTTCTGACGTCTCAAAGAGAAAGCGCAACAGATTCGATTCCAAAAGAATCGCGAGCGTTTTCATGAGC
GGCAGCGTCACGCGATCGTCTTGTGCGTGGCGCGCCAGAAGCGTCACGAGGAAGAACGCAAACCGCGTGAGCAAACCAAGGTTCTTCTGTTGCACGTGGT
GTCGCACCCACTGGAAAAGCGCGGTTTTTGACGATTTCACGACGCTCTCGGTCAGTCCGCCGACGCTCACGACAAGCCCGGCACTCACAGCTTCGACGTA
CTCTGGGATGCTCATCATCTGCACCACGAGCGGGAACGTGTCGTGGGCCATGGACCAGTTGATGTGCAGCGATTTTGGAAAGATTTGTGATTCCAGCTGC
TGGCGATCGGGGATACCATCGACACGAGGCGCTGACGAATGCAACAGCCGAAAGAGCACTTTGCCCGAGACCAGACGCATTCCATCAAGTTTTTCAGCGA
GCTGCTTGCCGAGTTCACAAAACTGTAATGGAGCAAGCGAAGAGTGAGAGTGAGAACCGTCAAGTGATGACAAAGATCAAGTGTGTGACATAAGAAGAAG
CAGCGCACACGTACAAATTCGCCGACAAGATGTGGTGAAATTCGCTTCACAAACGGCGGCTGCGCAGCAATTGTACGCTGTTTCGATTCATTTTCTGCAT
GCTGCTGGACCCACGCGGCACGCTCTGCGAACGCAGGAACTTGCAACATCGTCGCATCCGCAGTGCTTTCTTTGCGATTACGAATCTTGAGTTTGCTTAA
ATGGACAAGACCCAGTCCATGCGGTGGGAAATAATAAAACCCGAGCGACGGCTTTGCAAACTGCACCACACAAATGGGGTCCTTGACGGCGCGAGATTCA
TCGTCGACATCACCGCTCACTTGATCCTTGCTTCGTCGCGGATCGGCCATGACGCGGGTGATCGTACCCTCTCCGTACTTGCTGTGCGCTGTGAGACCCA
CAAGCGAGCGCGACTTGGAGTCCTCGTACGTACTCTCGCCGAGAAAGAGCTTCTCAAGTGCGAGAATGGCTTCTTTTCGGATCCACGAGCCCACGTCGCC
GCGCTCATCCACGCCATAGTCGAGTCTAATGCACTGCACGAGTGTGTGCACGATCTCATCCTCCAAGTTGTCGAACTGTAGATCATTGCTAGAACGCGAG
CAAATGTCCACAATCGCTCGAACTGCTGCAACACGACTTTCTGCGTCTTGTTCGTCCGCACTTTGCTGTCCGATAGAGGCTGCCCGCAGAAGCGTCTTGA
TGCAATTAGGAAGCGAAGGTTGCAGGAGCTCTTTGGGCGCGACACCGATCGCTCGAAGGAAGCCTCGTCGTGCAGCAACGTTTGGGTTAAACGCGACGGA
GGATACGCTACCGCGCTCCTTCACGGACACCAGGACGCCTGCATTCAAGTAGCGTGGCACGAGGTCCTGTAAGAACTGCACGTGGGCCTTGGCGCCTTTT
TCGAAAATCTTGGGACAGTACTGCGCCGTGAAGATCGAAAACGCATCAATACCTGCATTGCGAACGCTCTCGACGGGATGCACAATGCATTCTTCCAGAA
TAGCCAGATACTTTTTCACATGCACGAAGCTGAGACTCAAGCCGGCGCACGCATTTACCTCGATGACATTGCACACGGCGGCACGGATCAGTTCCCCACC
ACGTCCGCGAAATAGTCGGCGCTTCTCGACTTCAATCGGCATCATCTTGAGCTCCTTCTGCAACTCACCATCGAGAAACACGGGCACTTGCGCCAATGAT
AGAAGCAATTCCGCGATCGCGAGCGTTGCACCGTGGCGTGTGATGACTTCGACATCGCTCGAGAGCGCATACGCGAGCAATCGTGGGAATAGCCGCGTCA
TGGCATATGGTGGATCCAATGTGGCGATCTTTCCGAGTGCCGTCGCGGCATGCGTGCGAATATGAGCATCCCAGTGCGAAATCTTGGTGGTCATAAGGTG
GTCCAGCAGGTGGTAGCGATACTCGGGATACTTGGCAATAAACACGCTCACNNNNNNNNNNNNNNNNNNNNNNNATACGCGTGCCGCAGGTTTGAGACTG
AAAAGTAGTCGGCTTTCGTGAGCAGCTCGATGCCATGTGGGAAATTCGTGCGGCCTTGGCGCCCCACACACTCTTGGAACGCAGCCGACGCTGCGCGACN
NNNNNNNNNTTCGCGGTCAAACACACAATTCACTAGCATCGCTGGTGCTAAAATGGTCTCAAGACATGCCAGAAACAGCGCTGGTTCATACGCGCGAGCA
AAGGACCAGCATGCATAGCATGCGGCGTCGCGAACGTGAGACCCAATGCTGTGCGCTCCTCGTCGGATATCATACTGTAGTGCTCGCGCGACGCACTGCG
CGGCTTCCGGGAGTCGTTGCGGCAAGAGAACACCGCGTCGTGCTAATTCAGCGAGCGCGAGACTAGCACCATGCCATGCACCATCGCCCTCAGTCGCAAC
GAAGAGCTCCAATACCGACTGGACGATATCGNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCAGCCGTCCCGTGATGCGTCCGATGCCTTTCGCGGCGGAC
CACCGCACCACGGTGTCTTTGTCTCGCAGCCCGCACAAGAGCACCTCGACAATCTGCTCCAACTCTTCGATCGCGTCAAGCTCCACGTCATCAGCATCGT
TATCGTCTTGAGTTTTCGGAGTCGATTGTGCACTGGATGCTTGTGAAGCAGTACCAGAGCTCAAGCCGAACGACTGCATGTTCATCTCTAACGAGCGGAG
CCCGCGCTGGTATCGCCAGGATCGCACGCGAGGAGGCAAGTATAGCAAACCAAGCCGCTGCACGAGCTTCACGCTGAGCTTGCGGTGCAGCGTACTACTG
CTCGGTCGATCCGCTCGCGCGTCTTCTTCGGTGAGCTTGGTGATGAGCTGCATGACGCTGCTAAAGTACAGCTGACTCGCGTGGATGTGCTGTTCTCTCG
GGGAATTCTTGGCGATATGCGCGAGACTGAGCATGACGCCAGTGACTCGGAATTGGTTGGCGCGCATGTCTTCGCTCTCGTACGCCCTTTTGAGCTCTGC
GTTTGCCCATGTCAGGAACTGGTTCAGATACAGCGCTTCCATGTCGGGACGACTCAGAAGTCGCGACAAACACACCGACGCTGCCACTTGGGTCGCACCT
GGATCCCCCAAATACTCCTTGCACAATGTCAATATGTTGGATACGATCGAGATATTGCCGCTAGCGTTGCCTGCAGATTCGGAAGACGCCGTGGGGATGG
ACGAGTCGATTGTGTTGAGGTCAAACGGTACCAAGCACAGCATGGAAAGCCATAACAGCAGCACGTAACGCGTCTCCCACGTGCTGTGATCGGTGCGGTC
CTGGGACTGCAGCAGCATCAACGTCGGCTNNNNNNNNNNNNNNNNNNNNNNNNNCGCTCACCTCGTGCGGCAATAGCTTCACGATCGTCTTGAACCCGCG
CACTTTGCAGAGGTGGTAGATCAACTGGAAAAGCTTGTGCAGCTTCGGGTTCTTGTACACTTGGAACGGGAACGCGACGACCATCGTCGGGTCCTNNNNN
NNNNNGTTAAGGCGCGCAGCTTCTACTTCCCGCTCAAGGACAATCGTCGCGATCACGCGCTTCACTTGCGCCATGATTGGGTCCACGAGCTCGCGCAGGA
ATGGGTCCAGTAAGTGCGACTGCTCCAAGTACCTGTCCAACTAGCCATTACCACATACCGTAATCAGTCAGATGCCTGCAAGACACACAGCAAAGAATGG
GATCGTGCAGATAGACGGCAGACTCACAATGACCGTGATCGTCTTGAACTTGTGCTCAAAAGCCGCGTCGACGTCGCTTTCGTGGGTCGCGAACTNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGTCAGCAGCTGCGCCACTTGCTCGCGCTCGTCAAAGAACTTCTTCTCGCTGCAGCTCTCTTCAGCCTTCGCGAG
CTCTTGATCATCGTCGTCGTTTGCGTACGTGGCTTCTGCGTCTCTAGCGGCT