Description :
From Genome Similarity Track
Location :
Scaffold_70:134864- 136855
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_11959endomembrane protein 70-like protein, putative

Sequence
1991 bases(100 bases per row)
CTTTCTAGTCAATCTTGATGGACGAGTAGATCTTGCGGATAAACCAAAAGCAGGCAAAGTACCCGATGGTGCCCGTGAGGAAGAAGAACGTGAGCGAGAT
CATGCCCATGTAGCCAAAGTAGAGCAGGCCCGAGACGAACGCGGTGATGTTGAGCTTCGAGAAGAAGTACAGGAACGAGTACAAGAAGAGGTACAAGGCC
GCGCTGCCCGACGTGAGGAACGAGCGCCACCACCAGTGGTAGTCCTCGGCGCAGAGCTGGAAGTAGCACATGACGATCGTCACTTCGGCGCACGTCGCGA
CGAGGATGAGCAGCACGAGGAAGAGGAAGCCAAAGACGTAGTAGATCTGGTGGAGCCAGAGCGCCGACATGATGAAGAAGAGCTCGATAAAGACCGCGCC
AAACGGGAGGATGCCGCCGACGATGATCGCAAACGGCGTCGAGAGGTACCAGACTTGTTCCGGGATCTGGCGCGCAATCTGGTTGGTCTTGACCGGGTGC
TCGATCGCCGGGCGCTTAAAGCCAAAGTACGATCCGAGGCAGACAAGTGGCACGGAAATGCCAAACCAGAGCACGAGGAGCGCGAAGAGCGTGCCAAAGG
GCACGGCCTGCGACGACGCCTTGGCCCAGAGCACGAGGTTCAGCAGGAAAAACACCAGAAAGAGGCAGCCCGGGTAAAAGACGGCGGTCGAGACCATCGT
GCGCTTCCAGTCCTTGCCGTGAAACATCTTGTACGTGCGCGAGCTATGGTAGCCGGCAAACGAGCCCATAAACACAAACAGCAGCAGGAGCGTCGTGAGG
AGCGACCCGCGGTTGGCGGGCGAGAGGAGGCCGAGGAGCGCAATCACCATCGTGGCCGCCGACATGCAGCAGACCTGGACGCCTGTCCCGACAAACACGG
AGAAGAGCATCGGCGAGTACGACGGCGGGCGAAACACATCGGCGTGCACGAGCTTCCAGCCGCTTTCTTCCGCGGCTTCTTCCGACGTCTGGACTTCGTT
GTAGCGCGCGATATCGCGGTGGAGCGTCCGGAGCATGATCATGGCGATCATGCCCGTGAGGAAGAGCACAATCATGAGCGAGTTGATGATCGAAAACCAG
TGGATCTGGTCGTTCGACGCACGGCTCGAGAGGATGCGGTCCCAGCGCTGCTCCCATGTAATGTCCGACTTGACGTACTGCACGTCGTACGTGTAGAGCA
CCGTCGACGGCGAGTTGGGCTCGAGGTACGCGTGGTGGCCCTCGCTGACCTCGGCAATGTCGACAAACTTGCCACACGTGTCCTATGGCACGGAAACATG
AAACATTGGGTGATGCGACGACGAGAGACGCACCGACGTGAGCTCTTCGCCGCTCGACGGCGAGCCCTTGAAGAGGTGGTTGATGGACGTGGGCACGACC
TCGAACCCGACGACGCGCCACTTGGGCGTCGCGGGCTCGGCGTACGGGTCCGGGTGCGTCAAGACGACGATGCGCACGTGGTTGTAAATGAAGTAGCGGC
CTTGGGCGTCAATGTCGCCGAGCGGGAAGCCGCGCTTGTAGGCAGCCGAGAGCGGCGCGTTCGGGTCCTTGTTGACCGGTGCGGCCGCCTCGCCGTAGCT
CGTGTCTTGGTAGAGCACCGGGAGGTTGTCGAGGATCCACTGCACGTAGTACTCGTCTTCAATCATGTCGATGAAGCGCTGCGTCTCTTCGGCCGTGTAG
TGCATCGGCTTGCAAAGGATCTGGCAGCGCACGTCCTTGTGCATGTGCAGGCTGTACATCGAGTTCATAATGGCGTCGCCCGACATGATTTCGCCAAGGT
TCTCTTGCTGCTCTTCCGGCGCGCTCGGCGCGCAGAACGGCAGGTAGTAGTACTCGTACGGCACGAGCGTCTTGACCGACGTGATCTTGTTGACGTTCAG
TGGCAGGGCCGCGCCCTCCTCCCAGCTCTCGGGGGCCACGCCGGGCACGTAGAAGGCGGCGTCGACGAGGCTGCTCGTCAGCAGAAGCGCG