Description :
From Genome Similarity Track
Location :
Scaffold_84:134856- 136844
Transcript NameFunction/comments
Hyaar_Emoy2808623myosinlike protein putative
Hyaar_Emoy2808624myosin-like protein

Sequence
1988 bases(100 bases per row)
CTCCAGTTCCTCCAAGACACCCTCGCGGAAGTAAACACGGGTCAAACCCACCTGATAATCCTGGATGTTGCGTCCCGACAGCAGCTTTTCCATCAACTTT
TCGCATCGGGTTTTGACATATTCCATGTCTGAGTCGCTTATGGACTTTTTCTGCGTCGGAACCGCACCTGTACGCAGCACGCGGAATTTCTTGATGCACT
CCAGGTGCGGCATACGGTTCGGGTATGCACTGCGAGACACCCGGATGGCCTCAATCACGCCTGCGCAACGCAGCTGGCTGACGACGTCGCCGTGTGAGAA
GCAGTGAGCACTCTTCAGCGGATTTGGCTTGAGACAACGCACATAATGCACCTCCGTAAGTCCAATCTTTTCCATAAGCTGTGACAAACTCTCCTTGAAC
TGTGTGCCCACCGTCGTGCGGCGCGTCTGGGCGTGTCCTCCCCTTTTGACGCTGCCACTGCGCTTTTTGCCACGAGCGCTGGATCCACTGCTCTCTACGC
ACCTAGCATTCACGTCATCCGTAAACATCTTGGACAGAATTTTGAGCTTGGACATGCTCATGCACTGCTTAATATCCGGCAAGATGGCGTCACGGTGTTT
GTCCAGAAAGCCTGTTGCATCGTAAGTGACCTTACCAGCGTAGTGATAAATGGAGAAAGCACACTTATTCAGCCGAGGCGTCTCCAACAGCGGATTGTTG
TCCATCACTGCACCCAATTTGCTTGCAAACGACGCATCCGTGCCCGTGGCAAGCAGCGACTCCTCGTTCAGAAAGCTGATGACACCCAGGCGGCCTTCGA
TAAGATTCAGCACGTCTTGATTATCTGCGAAAGTGATGTGAGACCACGAAATGTTTTCTTCTTCGTATTCAATCTGGACCGTCTTCAGCACGTCCTGCAC
AAACTTCTGCTGCAGCTTCTCGTTGGCGTAGTTGATGCAAAACTGCTCAAACGAGTTGGTCTCAAAGTGCTCGAAACCAAAAATGTCCAAGATTCCAATG
AACAGGCCAGCACCTTTGGTATTCACGCCAATGGTCTGATTGATCTGTTCCACGAGCCACAAGAACAGCTTCGAGTACAGACTCTTGGCTAGCGCGTCAC
GACAATCTGCCGCCTGGTCGTGCGTCATCGGCTTCAAGATCACCTCCCGACCAACGAACACGTTACGGTTGCACACAGCGCGTTCCAGTGCCTCTGGACT
CACACCAAGCAGTCTGCAAGCCACATTGAAGTGTTCCCGATCCACAAGCTGCGAGGCATCCACATCTCCATTCTGCGTAGTGAATTCCGTCTCGCCTAGA
TGCAGCACGGCGCCAAGAATGTAAAAAATCTCCTGTTGTAACGACTGTTCGATGCCGACTAGCTCGAGAGCTTCGCGGGTACGACTGAGATCGCCTCCTT
CGTCACCGCCACGACCTTGCGTCTCGACAGGCACGTACTTGAACGAGTCCACTATGCCAAGCTCTAGCTCTGAAAACTCTTTGCGCTGTGCTAGCAGCTG
GTAGAAAATATGAAAATTGCTTTCTCCTTGCGCTTGGGTCGTCACACGACTCTTTTCCAGCAAATATGTGCGAGATCTGGCCCCGATCAATTGGCCTTCT
GTCGTAAACTGGAGCTCTGTAAACTTACCGAAACGGCTGGAATTGTCGTTGCGCACGGTCTTAGCATTGCCGAATGACTCGAGCAGCGGGTTGGCCTGGA
TAATTTGCTGGATCACTTTTGAGTTGGAGTTCGTGGCCAGTGCCGCCAAATGGCTCATGACAATTTTCGTCGTCTCAGTTTTGCCAGCTCCCGACTCACC
CGACACTAATATGCTCTGATTTTCCTGCTTTTGTCTCATGTTGAAAAAAGCCTCCATCGACACGGCGTAGACGTGCGGAGGTTTATTTTCCCTTTTTCCA
TCACTGAACTTTTCCATAAGCGCCTTGGAGTAGAGATCCAGCCATTGATACGGGTTCACCGCAATGCAAATCCGTCCTGTATATGTAT