Description :
From Genome Similarity Track
Location :
Scaffold_5:1348502- 1350553
Transcript NameFunction/comments
Physo_547613callose synthase, putative

Sequence
2051 bases(100 bases per row)
TTGCTGCCGCCTACGAATCGCAAATGATGCTGCGCTTCGTCGTGGTCTGGAATGAGATCGTCAACTCATTCCGCGAGGGTGATCTGCTGGACGACAAGGA
GGCGGCTATTCTCCAGTACGACATCCGCAGCACCGGCGAGGTGTTCGAGCCTGTATTCCTGTCAGCCGGCAAGCTGACGGAGGCCATGAACCTCGCGATC
AAGATGGCCAAGGACGGAAAGGGCGAGTCGCAGCTGCGCGTGGCGCTCGTAGAAAACGACTGCCTCTCGGCTATCCGCTCGTTCTTCACGGCCAGCATGT
ATGTCGTGGGCGCTCTGTTCGGCAACGACGACGCCGATGTGATCGACGGCTTCCGTCAGATCGAGGAGATCGCCGCGAGCGGTGGTTTCCTGAAGTCGTT
CAACGTGCGTGAGCTGGCCAGCCTTCGCGTGGCCGCCGTGGACCTGCTCGAAGAGATCCTGGACCTGCCGGACCCGGACGCTCAGTCTCAGCACATCCCC
GACGCGCGCGTGCACTCGATGGGCGTGATTCGCAACTTCGTGTCCAAGATGGAGGCGTTCCTCAACGGCGTGCAGTCGTTCTGCGTGGACCCTGCTCTTC
AGCGCAGATTCGGCAACTCCAAGTTCTGCTCCAGCGCCAACGGATACATGTACGCGTCGCGCGGACTGGTGAACCTGTTCTGCAGTGACACGGCTATGGG
CGCCGCTACGCGTGCGTGTCTGCTGCTGTCCCTGGACCGATCGGAGGCCATGCCTCGCACGACCGAGGCCCAGCGTCGTCTCGGTTTCTTCATGAAGTCG
CTTGTCATGGACATCCCGCAGCTGCGTTCCATCAAGGAGATGCGCAGTTTCTCGGTCGTGACTCCGTTCTACGCCGAGACCGTGCTGTTCTCGCTTGAGG
ACCTGAACAACCCGCTCGTGAACCACCCGATCTTCCAGCAGGTCGAGGAGGACGGCAAGAACCTGACGATCCTCAAGTACCTGACGAAGATTCACCAGGA
GGAATGGGACAACTTCCTCGAGCGCGTTGACGTGAGCTCGGCGGAGGAGGCCCAGAAGAACCACCCCGAGGAGATCCGTCTGTGGGCGTCGTACCGTGGT
CAGACCCTGGCGCGTACCGTGCAGGGCATGATGATGTACGAGGATGCGATCAAGATTCTGCACTGGCTGGAGATCGGCTCGAGCCCCGGCAAGTCTGCGG
AGCAGAAGCAGTCGCAGCTGCAGGACATGGTTCGTCTGAAATTCTCGTACATTTGCGCCTGTCAGGTGTACGGCAAGCACCGCGCGGAGGGCAAGGCGCA
GGCTGCGGACATTGACTACCTGCTGCGCGAGTATCCGAACCTGCGTGTGGCGTACGTTGACACGGTGGTGCACGAGGATGGCGAGAAGTCGTTCGACACT
GTGCTGATTAAGAGTGAGAACGACGATATTGTGGAAGTGTACCGTTACTCTCTGCCTGGCGACCCGATCCTCGGTGAAGGTAAGCCCGAGAACCAGAACA
ACGCCATCCCCTTCACGCGCGGCGAGTTCGTCCAGACGATCGATATGAACCAGCAGCACTACTTTGAGGAGTGTCTGAAGATGCCGCAGCTTCTGTGCAC
GGCCGACCTGCACCCGTCGAAGAAGCCCGTGTCGATCATCGGTATGCGTGAGCACATTTTCACGGGTAACGCCAGTTCTCTCGCCAAGTTCAAGACGTGG
CAGGAACTGGTGTTCGTGACGCTGTCGCAGCGTGTCCTGGCCGAGCCGCTGTACGTGCGTATGCACTACGGTCACCCGGATGTGTTCGACAAGGTGCTGG
CGATCACGCGCGGTGGTGTGTCGAAGGCCAGTAAGGGCATCAACCTGTCGGAGGATGTGTTCGCTGGTTTCAATACGACGCTGCGCGGCGGCGTCGTGAC
CCACGTGGAGTTCATGCAGTGTGGTAAGGGTCGTGATGTGGCTCTGTCGCAGATCTCGATGTTTGAGGGCAAGCTGGCCAACGGTGCCGGTGAGACTTCG
CTGGCTCGTGAGGCGCATCGCATGGGCCAGTTCATGGATTTCTTCCGTCTG