Description :
From Genome Similarity Track
Location :
Scaffold_6:13485- 14904
Transcript NameFunction/comments
Physo_128847hypothetical protein

Sequence
1419 bases(100 bases per row)
CCTTGAATGAGGACGATGAAGACTCCACGAGAGACGACGAAGCCATTGCGCTCTTGATCTTGGGCAGCATGAAGCTCGACTTCCGTCGCAGTCGCTCGAT
GTCGGTCTCAGCTAAAGAGGCAGAAGCTGCTGCAGCTCCGGAGATGGCTGCAGCCGACGCGGCCTCTTCGGCTGCCGTAGCTCGAGAGAACAAAGCGTGA
GAGAGCAACCGCTTGCGCTTCTGCCAGTTCTGCCACGACAGGAACCACGATCCGTCACTCACGCGGCTGAACTCGACGCTGTTCAACGCCACCAGTACAG
TGTACACCCCTTCCTGGGGGAAAGCTGGGGCTTGGCACAATATTCGCTCGGAAGACACGAACTTGGCCACCACGTCGACGTACGATGCGGCCTGCTCCGG
TACAGCGGGTGATGATGTCTCGCTGTTAGCAACTGGACGTTTGTCGAGAAAACTCGCGCTCTTGACTGGTGACAACCCCTGCGTTTGAGGGGCCTTTTGA
GATGCGTTTTCCTCTTCGATTCGAGGAGTGGCTTCCTGCTGCTGCGGCTCCGTGTAGAGCTGGAACCGCACGATGATTTTACCAGTGTCGATGAATCCAC
GACCCTCAATTACGACGGCAAAGCCCCCGTAAACCGGTCCATCCATAGGCGAGACCAAGTTCACTGTGGGGATTTCTCGGTACACATTCAAAGACAGTGG
CGAACCGGTGAACTATCAAACACAAAATACTCAAGTTGGTCAGTAAAACTATGCCTTAGAACGAACGAACGAGCCAAACCCACAAAAGTGTTGAAAACAT
ACCGCGTTGTGTTTCCCACCCAGCCAAATGTCAACGAGGATGGGGGACGCCATCGCTGTGGCTGAATGAGCGGGTGATTTTTCTCGTCCGAGCGATGATG
AGGCTTGCAGTATTTCTCTCGGAATCGGGCAGCGCACCTGGCCGTTCTCACAGATTCCACGGATAACCTTCCGGCCGCGACTGCTGCTGAAAGACACCTG
GACACTGGCAGCTTCGTGTTGTCCTCGGTTGTTGTCTTCCATGGAGGTTGCAGAGATCGTAGCGGTGAGGTTAATGCCTCTCAGCTCGAGCTCCAACGTC
GTAGTGGCCGACACCCAGCTCGGAAAGAGCTCCGTTAATCGTGGGGACTGGAACACACGCAGTTCACCGGGACACTGCACAAACTCGACGCCGTTCATGG
CCACCGCAACCCGTACGATAACTCCTCTCGGGAAATCAGGCACGCTGCACTCCATGCGTGTACTGGACACGACAATAAGTCGCGCTGTGCGGACTTCCGG
ATCTACGGCTTGGGTGGTAAAGCGCGCTGTAAACAGAAAACATTGTAAGACACGTTAATGCTGAAATCCACACGAAACCCAAAACTTACCAATTGCGATG
CCCGTGTTGGTGAAGTTTG