Description :
From Genome Similarity Track
Location :
Scaffold_241:13481- 15864
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_241-fgenesh-gene-0.3Bifunctional folD protein
Pytiw_DAOMBR242034maker-piw_contig_241-snap-gene-0.16DNA ligase

Sequence
2383 bases(100 bases per row)
GACCCGAGCCAGCGCCGCGCCATCGTGCTGGATGGCAAGGCCACGAGCGCCAGGATCCAGACGCACGAGCTCGCGCCCGCCTGCGCCGCGTTCCTCGAGC
AGCACGGCCGCCGCGTGGGGCTCGCAGTAGTCGTCGTGGGCGCGCGCAAGGACTCGGCCACGTACGTGCGCATGAAGCAGCGCGCGTGCACTGCCGTGGG
CATCGAGTCGTGGAAAGTGCACATCCCCGTGCCGGACGACGTCGTGGATCTCGACGCGCGTGTGCAAAAGCAAGCGGTCCAGGAGCTCTTGGACACGATC
CAGAAGCTCAATGCGCGCGACGACGTCGACGGCATCATCATCCAGCTGCCACTGCCGAGCTTCTTTGATGAAGACGCGATCCTCGCGACCGTCGCGCCGG
AGAAGGACGTCGACGGCCTGCATCCCGAAAGCCACGCCGCGCTCTTCCAGTTCGCCACGAAGAAAGCCCAGAAGAGCAGCAACCAGGAGGCTGTCTCGTT
CAACATCCCATGCACGCCCGCGGGATGCCTGGAACTGCTGGACACGTACGACATCCCCCTCGAAGGCAAGCGCGTCGTCGTGCTAGGCCGCAGCCAGATC
GTTGGCCTCCCCGTGTCCATGCTGTGCCTGTACCGTAATGCCACGATCACCATTTGCCATTCCAAGACGGAAGATCTGCAAGCCCGCGTGCTGGAAGCCG
ACATTCTCATCGCAGCGATCGGTCGTGCGCACTTTGTACGTGGCGACTGGATCAAGTCGGGCGCGACGGTCATCGACGTGGGCATCAACGCCGTGGACGA
CGCGAGCAAGACTGCCGGGTACCGTCTCGTCGGCGACGTCGACTACGAAGAAGCGTCCAAAGTCGCACATGCCATCACGCCCGTGCCTGGCGGTGTCGGC
CCCATGACCGTCTCTATGCTGCTGAGGAACACAGTGCAGACCGCGTATCGTCGAAAGCGTGCGATCACGGCTTCGTCCAGCTGAAGGCGTCGGTTGGTAT
CTGTAAAGCTTGAAATTGTCGAAACTTTGTGAAATTGTCAACCAAGAAATGAATTTGACAGCAAGCCTGAACAGCATCTTCAGCACCTGAAACTCGATGT
CGGTTACCATTCTTGGACTTGTTAGCGACTAGAATGCATCGTTTTGATCGTTTATCTCGTCGCCGCCACCATGGTCCAGGAGATCTTCCTCGTCCTCTGA
CGAGAAGTTGCCGCTTTCCTCCACGAGCTGCACCTCCTGATGCAGCTCTTCCCAGTACCCGACCCTCGCGGATCGAACCGAGCCGCCTCCAGGAGAGATC
TTCATGGACCCAGTTGGAGACGGGGGTTTGTAGTAGTAGGATTTCCCTGACGTCTGCTGCTGCTCCAGCTCTGCTTCGAGAGCGACGAGATCGTGATCCA
CTCCATCATACTGCTTTTGCGCACGGAGCAGCAGGCGAGCGCAGTCAAAGTGCCCGTATGCCGCGGCGACTTGAGCTGGGACCTCCCAGTCGTTGTTCAG
AGCGGTCGGATCCGCACCGCAGTCGAGTAGGGCTTGAGCGACCGCCACTCGACCAGAAAGAGCCGCGTAGTGGAGTGGGGTGTCACCACGCTCGTCGATT
GTGCTCATATTCGCAGCACGACCTGAGAGAAGCGAAATTACTTGGCCTGCGTTTGCAGAGCCGACGCTCAGATGCACAGATGAGCGCCGCACGCTGTCCG
CATCATCGATCCAGCTGTCTGGAGTGTTCTCGAGCAACAGAGTTGTCATGTCGAGGTGGCCAAAGAGGATCGCCAAGTGGAGAGGAATCCGTCCGTTGGC
ATCACGTTGGCTCAAAAGCGCACGACAGCATTGCTGGTGGACCAGGTTCTGCGAGGAGAAGATGAGCTGCTTTGCGCATTCGACGAAGCCCTTCTCCGCT
AGGATATGCAGCGGAGAGCGGCCAGTCTTGTCAGGATCATGGAAAAATAGCCTCGCCTGCGAAACGTTGAGCTCTGACGTGTTGGAAAGATTGAGCTTCT
CGTGAAGGTACCCGCAGACCTCGACCTGGTCGAGCTCACATGCTCGATGAAGCACGTTCTGCATCTTCTTGTTGACGATCGTCAGGTCGGCACCATAGTC
GATAAGCTTTCGCATCAACTCGAGATGTCCGTTGACTGCAAACAGCATGAGTGGCGTGTCTCCGTGGTTGTCCAGCGCGTTGACATTCACGTAAGCGCGG
TTGATCAGGAACTCGAGCATCTCGAGACGAAAGCGGTAGCTCTCCGAGCACAATGCGAGCATGTGCAGCGCGCCTCGGCCGGTCACGGGATCTGCAGCTG
CTGCAAGATCAGCGCCTTGGTCGAGCAGGAATTGAGCATCCTCGACCGACGCGTTCGCGACGGCATCGAAGATCGTCAGCTCC