Description :
From Genome Similarity Track
Location :
Scaffold_101:1348- 2387
Transcript NameFunction/comments
g14964.t1hypothetical protein

Sequence
1039 bases(100 bases per row)
CGAACAGCTGTCGGTACACTATGTTCGCCGTCTTCTTCCTCCCGCTCTGGATACTCGACCAACGCCTTGAATCTCCATCTCGACGTAACCCTCGATATGG
CCACATACAGCTGACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGGTACTGCACCGTTTGTCCCTGCGCCTTGTTGATCGTCATGGCAAAGGC
AGTCTGGATAGGAAACTGCCTGCGTCTCAGTCGAAATGGGAAATCGCGGATGTCGCCATCGCTGATGAACACGATGCGCGGGATCAACACATGCTGGCCT
TGCCTGTCGCCGGCCATGATGGTGGCGTGGATGACATGGTCTTTGAGTTCGACGATTCGCAGGCGTGTTCCGTTGCACAACCCCAGGTCGGGATTTAAGT
TCCGCATCATGATGATCGGCATCCCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATGCCACTGATGTTCAGGGAGTTGAGCACCTGCTCGAATAAGTTCCC
GTCCTCGTCATCCTCCACTGAGTCCGTGGACACATATTCTCGAGCTGGCCCAGTCATGCGATCCGCTACGGCTTCGTTGATACGATGGACTATCGCGTTC
GTGGTGGGGAGGATGGTGCGACTCGCAAAGTACTCGTCCGTTGCGACTTCCGAATTGTTGATGTCGGCGTACATCTCGTCGATCGTGCGCCGCATACCTC
GCGGAATAGCTCCCGGACGGATCTCCTCGTCCTCATCTGGATCACCGGCGGGTTGTCGATGAGCATGTCACGTGGAATCTTAATGTAGTCATTTCCCAGA
TCATTGTGTACCTCGTGTCTCCCCTCTCCAACCTTCAGCAGGTACTCGGAAAACGCAGCCATTTCTGCAGCACTATCAGAGGTGGCAGCCGTGCGAACAC
GCATGTTCTCTGTCAGACGCACCTTCTGGAAAAGTGGCCACAGTTCGGATGACTTCAGGCATGCGTCGATTGTCTCTGTCGCCGAGCCGCCCTTCACCAC
CGGGAGAATTTGCCTGGAATCTCTCTGAAACTCGACCAC