Description :
From Genome Similarity Track
Location :
Scaffold_667:1347- 2591
Sequence
1244 bases(100 bases per row)
CATCCTTCTCCTTCACGCGCTGCACCTTCAAGTGTCACTGCGAGATCAGCACGCGAACTGGACTACGCGTTTGAAGAGAGACTTCGACTTATGTACCCAC
TCTAACGTCGAGAATCGTGTAAATACATGTAGCGTCGTTCCTATCAGCTGGACGTAACAGATGTTCATCAGCAAGAGTAACGCCACAACCTCCTTCTCAC
GAGGATAATAGTTCATCTCGAATTCCTTGAGCACACGGCTGAGGGAATCGAACGGGGTGTAGCTTGCCTTTCGTGTTCTTGCATGAGCGTAGTGCTCAAC
ACCCATTCATTCGCGAAGAGCATGACGTGAGCTGGTCTTCGACCGATCGAAGTGCCTGAGGATGGGTAAATGTGAAACACTCGCCTTTAATTTCTCGAAG
GAACGACATGCCACAGAAAGACCGCTTTCAGCGATAAAGTCTTCATCTTAAAGCTGGTACAGCGCCGCACCGTAGACCGCGAAGTCTTGAATGAAGCGGC
TGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTGCTCGTTGGAAACGAAAGCTCGGTGATGGCCGCAAGCTTCTTGGGGTCAGCTCTGAT
ACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGGCAAAAGATGCTCTTGGTGAAGCTAATGCTGATCCGACACTGTGCAAATCTTGCT
AGCAATCGGTCCAGCGTCGCCAGGTAGCTGTCGAAATCCTCGCCACCGAAGCAAATATCATCCACAAACGATCGTCGACCAAACACAGGTACCAGCGATG
ATTCGTCTGGTTCCCCGTTCGTAAACATAACAGCGACGGGATGTTGACGAGCTGTAGTACAGGGTCGGTCTCTACCGGTGCTTCGCGGTCTGCCGCGAAC
TCCGTTTGAAACGAACCCTCGGCGCTTGGCCCACGACATTCCTTGGCCTGTTCTTCAGCTAAACGCATCCTCTCCGAGTATTCAAACCAACCTCCTTTAG
GTTTAACGAACCCCCAGAGTGCGTTGTCAATCATACGCTGGTAGATCATCGGCGCGTTCGTTAACCCGAAGGGCATGCGTAACCACTCGAAATGTCCGAG
TGCGCAGACGAACGCCGACACTTTACGCGCTCGCATGGTCATCATGACCGCCCAGAAGCCGCTTGATGCATCCAGCGAGCAGAACCACAGGTAGCGATCG
AGGTCTGTTAACAGGTCGTCGACTAGCGGCATTGCATACTCCAT