Description :
From Genome Similarity Track
Location :
Scaffold_20:134686- 152622
Transcript NameFunction/comments
Hyaar_Emoy2803414hypothetical protein
Hyaar_Emoy2803416hypothetical protein
Hyaar_Emoy2803417hypothetical protein
Hyaar_Emoy2803418ribonuclease H
Hyaar_Emoy2803419copine-like protein
Hyaar_Emoy2803420hypothetical protein
Hyaar_Emoy2803422Clathrin assembly complex putative
Hyaar_Emoy2803421Clathrin assembly complex putative
Hyaar_Emoy2803423Clathrin assembly complex putative
Hyaar_Emoy2803424BolAlike protein putative
Hyaar_Emoy2803425phosphopantothenate-cysteine ligase
Hyaar_Emoy2803426phosphopantothenate-cysteine ligase
Hyaar_Emoy2803427hypothetical protein
Hyaar_Emoy2803428hypothetical protein
Hyaar_Emoy2803429putative tpr repeat protein oca3 protein
Hyaar_Emoy2803430hypothetical protein

Sequence
17936 bases(100 bases per row)
CGAGATGCGTCATATGGCTAACAAACGTATTCGGGTCCAGAGGTCGACTGACGCGGCGGCTCAAGCGGCAGTCATTCCCGAAGTAGTGTCGGCGGCCACA
TTTTTAACACCGGGGCCGCGCAGCTAGGTTCACCTGATGCATACAACTTGGTTACAGACGCACATCTGCAAGACCAATCCGTGGTCTCACGAACGGCCAA
CTCCAACGTCATCACCTGAGCGACCTTGGCTTTCGCGCCCCAATACGTGGACGGGGGCGGCATTGGCAGCACTGAACAGCTACGTCATCTCCTGCTGCTA
CAAAAATCCAGACAGGGGCGTATGATGTTCTACGGGATGACGTCGACGAGTCACGCGGTCTCGGTGATCGGGTCCGGGTCAAACCCGCAGCAGCGGTGTA
ACGGGGTGAGCATGTTACATGTAATTAACCCTTGATAATTGTTAATTAGAATATTGTAACGGGGCACGCTTTTGTGTTGACTGAACACAAGGTTATGTGC
TCCCGACGTCACGTACACGTGGCGTGAGGAAGCGCAGCAAAGTAAACAGAACTAGAAAGCTCTGTTTAAGGAAAAGTAGAACTGTATTTAATATAGTTAC
GTTTCTTTGTAAATCGTCTTTGTCTTGATCTAACTATATTAAACTGAAACCTCCTGTATGGGTTTCTTGCTCACCACCCATTGCGCGCGTCCAGCAGCGA
TTGGTGGTTAGTTTGGTTGATGTTGTATCTATTCCAACCAAACGTGGAGCACCCCAGAATATTACCCCCGGAGGTAATATCCTGCTAACATCACCTCTTC
TCAATTGGTGTTGATTGAATATCATCTAAATAGATAATATTCAAAAATTGATACATTCGTACCAATTTTATGTAACAGGCTCAACCCCGTTACAACATCT
GCAAAATAGGACCACACCCAGTCTTACACAGGGCGGTGGAAGTTCGGATGCCTCTAGTCCACACAGAGCGCTCCAGGGCGCATTACAAACAGGCGGAGTT
ACCTCGGGCCTGGCGGCTCGGGATGCAGGAAGTCGCTCGCATGCGCGTGGCCTGGTCGGCTGATAATGCGTTTATCGGAGTGGCCCTGTACAGTATCTCC
TGGGACAAGTTGCGCCGCATAACAGGTGGCACGGCCTCGGCGGAACAGTTATGGCCCTAGAATTAAACTGCGAGTCACGTCCATCCAGGAATTGCAACGA
TAGGTGCCGGGATGCCCTTTACCCGAGCGCAAACAAACTAACGTTACCTTCTCGCACCAATGTTGGGACTGTGCAGCAGCACAGCTTCTGTGGAGGGTCC
TTTCGGGTCCGTGGCAGCGGCTAGGTTCACCGAGTCCATACAATAAATTAGAGGCCATATTCTGCCTCACTCTATCTCAGGTGCTCAAGGGGATCTATAT
CTCTACGTGGAGCGCTTGAATGGACACTTACCATCGGGTCATAAGGAAGGTGTCTATATCTGTTGCTACTAAATACCAGAAGACTATCAGAAACTGGACG
TGACCCACACCCTGCAGGCCATGTGGTCTCGACGGTGCCGTAGCAGAGATGACGCTCTGGACACTCCACTTTTCGTGCGAAGGTACTGCTTCGGGGTCGA
CTACGGCAGGGCCACATCACCCTACGTGCAATTACATTGGAGACTGCGTTTCACGTTGATATACGTGCGGAGGCCCACTTCGTTCACACAGCTTTTCCAG
ACTTTGAGTCGGATGACGTGACGAGTCTATCTCGCGAAGAACAGCCCCTATATGCTCTTCTTTGATGGCGGGTCCCGAAGCAATCCTGGCCCGGGTGGTG
CTGGTGCCATTATTTTTATGTGTCCTGCGAAGCCTGCCTCGGCCAGGACAAATTGTAACGGGTGCCTCCGTTACATGATAATTTACATAAGGTAATTATC
AAGTATGAATATTGCGTCAGGAAAAACACAATATCCTCCCAATATTATCCTGATAGATAATATTGCCTTGCAAATGTAACACACTGCTCATTGGTTGATA
TAGCATCGAGATATCAACCAATAAAGTCTAGCCACGACAGAAGCACGCAATGAGTGGCGCGCAGATAGTTATAATACATGTTTGTATTTAGACATAGTTA
AATAAAGCAAATAGGGATTTATTACAAGGATTAACTATACTAAATACATTTCTGCTTTTTACCTTTACTGAGTACTCTACTCCGTATCGCAATCTTCCTC
TGCACGTACGTGTACGTGAGGTAGTTGAGCACACACCCTTGCACTGTCAGCAGCGCAAGGTTTATTCAGTTAGTTGAATAAGGTGTGCCCCGTTACACAC
ATTGGATGTGCAGCGTATCCCTCGCGGACCGCACCACAACAAACAATACAGCCGAATACAAGGCTCTACTTTTTGGTTTTCGCAAAGCACACGAGTACCA
TCTTCAACGTCTCCACGTTGTAAGCGACAGCGAACTCATCATGGGGCAGCTACGACGGAGGCGACCTCCGAAGACACCACGGCTCTTCGACCTTTACAGG
CAATTTCGACTACTGGGAGACCGGCTGGGCGTGATCACGTGGATTCATCACCTTAGACAATATAATCGAATGGCGGACGCCCTGGCAAACGTCGCAATGG
ACTCCAGGCGCAGCTTCTAGAATTTCGAACCTGAGGTGGCCACGTTGCCACCTATTTGGGTGGGCGTTAAGACGCATCTAAGTGGCGACCTAGACACTGG
CATGAAACACTATGGACTTTTGCTCATCAAGACACTAGACGGGGAGCTTCCCCTGGCTGGCAACCCTCGGTCACATTGCTAACACCATTAGTAGTTAGCA
CCGCGACTGGGGATGTGTAGGCCCCTACAGGACGGGCATTCTCGGGTCGTTAGTTTCTCTAAATGACTGTAATGTACCACAAAAAAAGGCTCCATAAACA
CATAACTGGTTGAGTTGTCGAAGTAAGTAAATTCATACATCATTAACGGAACCAAAATCTCGACAGGCGTACAAACGTAGTTTAAATGAGACTTGTTCAG
GTACGCCGCGAGGGTGGCACATAGAATTGAAACGGGTGTCCAGGATTTTACAACGCGCTTTCAGCCGTAGCGAAGACGGCGTTAGTGGGGAGACAAGTCC
ACATTGAAGTTGCCGTTGGCCAAGTCAAAACCATTTCCTATTCCACTGAATTCAAATGACCAAACACACTGAGATAGGATAGAAAGTTACTAACTGGTAC
GTACTATGTATGCACCCAACTGTTTCTTATACTTAGATAGGTGAAAATATATCTGGTTATAGCCGGAAGGAATACAAAGCTAGGCGTAGCTGCGGGTTTA
GTGTCAAGGACACCAACCCAAAATTCGGTCGAAAGGCAGTTATCTACCGGGGCATAAAGTTACACAGACGCCTTGTCTTAATCGTCGTGCCCACTCTGCG
TGGGTGATCTTTTTCAGCGATAACGTTTGTTTTTCGGCCTGATGTCCATAAACGTGCTTAGCATCAAAACTCGATATACCAATGTCGCGCTCCTAAACTG
TTTGAGGCCACCCGTGTCGATTCCTTTTGGATAGTATTAGTACAAGCTTAAGTTTCTTCGCAGGGATAAGCTACCTATGAAAAATTTAGACATTTCACTA
AAATTGCACTGAGAGGGTCGGAGGTATAAGGTAGGTTTGCGGCATCACTCGGGGTGAGGTGATAGTAGCTAAGGCTTGCAGTCATTCATAGAGCAAAGTA
GCAAGTGTGGGCTTGACTCTGTTCACTTGTTTGGCAGCTTGTAATTGGGGAATTAAAATGTGCGCAATTCGGTATTGAATATAGAATTAGAGGGGTGGAT
GTAGACTCTTTGGAAACTGGGGCTGGTTTACCGGAGAGTTGGCACGACGAGCACCATATAGTATAGACTTCTTGAACGGAGTAGTCTTTGACTACGTGAA
CGGTACGTGTTGGAATGCGGATTGACACCAGAAGTTACGGTTAGTTAGGGAACGAGTTGACAGGTTGTGCCATCAGGTAGTTGTATGCGTTGGAAGGTGC
AAGTTGCATTTGGTATCGACAAGTTGCATTTGGTATCGACGCCAAAACGCGTCTGGTACGCGTTATTATACAAGTCGTCTATTTTACTTCACTTTTACAT
TTCAACAATATGAGAAGAGGAGGAACCCAGTGAGGTCCAACACCGTTATTTTGGGCAGAGTGCTTAGTGTTTATAAATAGAGCCTTGAATTTGTCTCAAG
ATTCCGAGGTGTCAGGAACGGTAAAAAAATTCCAATAGTAGAATCTTGCGTAGTGACCACGAAGATTCATTATTTGTGCCGTTACCATTGTAGTCTCTTT
TACACCAGCCACAATCGTTTGCTCAATGATATTCACGACGGTCGTTTAAGAGGTGAGCATATCAAATTAATCGGCTGCCGTTTTGTGTGAGCTGATTAAG
TCTGAACACCAAATTACAAACGGTTCTTTTGCCTTTGCCCGTACTCCGGATAGATGGCATACAAGTTGTCTTTGCCTATTGCTAAGATAACATGGTTTGG
AAGATTGCGGATCACGTCAAGATCAATTTTCATACCACAGTCACATCCAGGATCTCCCATTTGGGCTTTATTAACTGGACATTTGAACTACTATGTCTGT
TGTGCATGGACCACAAGTGTTTATCAGCCAGCACCCGCCATCTGGAGAGAAACGACGGTTCTACACTTCCACATCCAGCGCGTTCGCCATTCTGTCACTG
GCGGCGCCACTAACCAAGTAGCTAGTTCCTTGGCGCTGTAGAGGCGTCCGCGGCTGGATACCCTTCATTTTGTAGTATTGCAATAATTGTGTTGGAATCT
CAGCAAGTGTTTCCTGCACAGTTTGCAAAGTCATGTTAGTCGCCATGATTCCATTCCCTACACTCATCTACAAAAATCGAACCTTGGCCAGTCTTGCGGG
ATTGCGACGGAACTGATTGAATGGGACAAACTGAACACTGTGGGGGCACGATTATCATCAATACATCGCGAAGGCCAGAAAACAAAACCACAAACAAGGC
TTACATATCGCGCATAGCTTTGCACCCTCTCGAGTCAACCAAGACCTTATCGTCGGCATCGAGGGCTTTCATAGCCGTGAAGTTAGTGTTGCCCACCGCG
ACAATCACGATGGACAACGGAAAAGTTGAAGCCTGCACCAGCTCGTCAACCGTTTGCTGCATGTCCATGATAGCTCCATCTGTGATAATGAGCAGCACAA
AGTACTTGAGATTTCCACCTTGCTCGGCCGGCGCTGAGAACGTTCGAGCAATAGCTGCTGCTTGGCGCACAATAGGTGCGAACATAGTCGGACCATGCAG
CTGCACGAATTGGAGGGAATTATAATACGCACTCAAAATCCCTCCAATTCCCTCCACTTCCGGCTGCAAAGGATCGAACGTCAACGGAAAACAGTGATTC
ACGGCTCCATTAACCAGTCCACCGAAACCGTACACTGGGAAACGCTTATCGGAATCGTAAGGCTCCAAAATCGCTCCAGTCGCAGATATAGCAGCTTGAT
AATCGTTCATTTGACCTTGATTACTTCCTCCGATGTGGTGCAAACTTGTAGGGTCCAAGTAGTTACCATTTGAAGCTGTGTAGTCGATGCCAACGATCAA
GCTAACTTCGCAGCCCCCGCGCAAATACTCTGCAAATGTATGCCGTTTGTAGTGTTCGATCTGTTCCAAAACCAAGACACCTGAATTTTTGTATCTCTTT
CCCTTTTTTGCTTGCCTGTCGCGGTTGATAAGATCCATACTGCGGAGCTCCCCAGACACGAATACTGCGGCTTTGACAGTACAGCTGCCGATAAATTGAT
GTTTTCCGCTTTTTTCCCAGTCCAAGCACTCAATCTTTAGCAATAACGACAAGTTTCCATTGCAAAGAGATTGGACGCTCAGAGTCGTGCGACGCCATTT
CGGGTTACAGTTGTTCATAATGACCTCGCTGCGCCACACCAGAACCCAGGAAGTAGATGCAAGCGGGTCAGCATTTTCATCGCGCAGTCGATATATATTG
AGAAACGGATCTGAAGCACCGAACCAGCCGTCCTTGTTGTCCAACTCATTTGCAGTAAACACAACGTTGACCATGTCAGCACATGTCGAAACTTCTGCGG
CTTCTATCACCACATGACCAGATAAATCGCGCACGCGTCCTCTACCATTGTCATTGTGTAACAGTTTGAGAACTACCGACTGACCCTTGGCGGACATCAA
TTGCCCCATCGTAATCTCTACACACCCGAGAAAATCATGGTCCGATAACCTTTCAGACGCACTGTCACGGTCAAAGACCTCGATCCGTAGTCTCTGGACC
TCTTCAAAAAAGAAATCCAATTGGAAAGACTGGACGAAGACCGGGTCCGGCGTGTTGCGAATAGATTCCGTGCGTCCAAGTTCCTGCCATCCCTTTGTCT
GATCCATTTGCATATATAGCACGATAAAGGGATCCGAGTGACTCAAAAAGTCAGACTTCTTCAGTCCTTTGCAGCGAAATCGAAGTTCCACGACGCTCGA
CGGCATCAAGGGTATTCCGTCCGGCGTCAAAGCTATTGGACTCGAAGATGACGAGAAGCTGCGTGGCTGCAACGGTCCGTAGCCGCCATAAAGCGTGGGT
TCACGCTGAAGACAGGCAGGTGGCTGCTGCACTGAGCCTGGAGGGGAAAACGCCTGGCTCGATCGGAGTGGGAGGACGTAAGGATTTTGCTCGTGAAGGC
CGCTATAATACGGTTGCTGCCGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTAGTTGCTGCTGCGGTTGATGCTGGCTGAACGAGCCTCT
GGACAGGACAGAGGGGCAAGTATGCTGTCCAATGTCCGGGTAGAGGCCATGCTGCTGCGGTTGTTGCATGTACGGAGGCTGGACGAAGCGGTGCTGGCTC
GGTAGCGAGCCCCGACGGTCTGGGGCTGGCGTTTGGTAGCCCGAGACGTCCGGAGGCGCTGACGGGGTCGTAAACGAGCGTTCACGTTGGTAGTACGCTG
GTTGCGAATACATTGTCGCGAATTCGTTAATGAACCAGTAACGGGTGCATGTCTCTCTATTCTGAGAACTTCAAGTGGCGACACGGCCGAAAAAAGCATG
GGATGAAAAATCCATAGAAAGAAGGATCATCTTTTGTAGTCAGCTGTACCTCGTCAGCATCTGTGACGAAACTTTGTTACCTTCCAGAAGTCGGACAAAG
TCTGCGATCAGAAACGCACCAATACTTAGGGCGGAATGTCGACTGGAATTTGTCTCGTTGCTCCTTGGCTTTGATGCTACTGGTTACCAACTTGTTTGTA
GTATAGCCAGTAGATATGGAAAGAACAACAGGCACAAGTCATGGCTTTTTGATGTGACTTTTACACATCAGCGAGCAGGTTGCAACAATTGATTTTCTGG
AATTGATCTTTCGATCGGTCTCGATGAAGTGGGATTTCTAGGAGATTACTAAAGTCATGGTCGCTTTCTTGAGCCGCAAGTTGGAGCATTCGGAGCTACA
TGGTCTGGTTTTGCGTCGTAAAGAATGGCAACATCGAGCTTTGGCTTCAGCCGAAAGCGAGGCGTTTGAGGATCAACGGCGCCCGACTGCAATTCTGCAA
ACAGCTCGATCAACATCATTAGCTGCTATCATGCAATGTCTACTGCGCTATACTACCGAAATCGATTGGTGAAATCAGGTGTTGACGCCAATCTCACAAG
GTCGATAATAACTAGTCGTTTTACATCGTGTGTTGGTTTATCATTTCAGCATTTGCACCTGGACTGCTACGGCCACGATACACCGCTGCACCCGTGCTGT
TTTGCGACACGTCCCTACGTGATCATTGTCTGCTTCATCAATGTGAAAGAACTTGCAATGCTAATCTGAGCGCGACCTATCGCATGAACTTATTAATCTC
TGCTCGCATTGTGCCGTTTAGTGATGCAACAAGTGGAGTTACTTCATACTTGCTTCGTGCCTGTTTCGTGTGACCGACACCTCTGAGACCGTAATGCAGA
TGGCCCTGTAGAGCTTGAATCCGTCCATTATTAGAACGATGCATCAGCTTCGGATTTCGTATCTGTATTGGCGAAGTGCGTGTGGAACTAGTAAGTCTGA
CCTACCGCAATATACCGACAAGGATAGCACAGTACTTGCAACGAATACCAGCCTTACAGTGTTTGTAGGAATCGTTGGAGATAATAGCATTCTATCGTTC
CCGACGTAGACTCTGTAAGACGAGCTAGGACATGACGGCGTCGATAATTGCACTTAAGAAACTCAAATGCTTACTCTCACGTGACATCAATCAGCATCAC
CGACACTACCGTCACGACGACGAAGTTTGACGCAAAAGACTCGCCAAAGTAGCGAGTAGAGGCTGCTTGAAGTACCTCGAGAAACCTTTAGTCGACGTCG
AAGCAGTGCGAGATAATACAGCCGTAGTCCTTATTGGAAAAGAACGAACGTACACCAGGGAGTAATTGGCAGCTTAGTGACACAATCGAGGACTCTATAC
TCGTGTATACGAAAAGCCTCTAACTGCATCTCGCATCTTTTATGATCCGTGCTCTCAGTGGCTTGCCATGAAGAAATTATAAACGCTGACAATTAAGACT
TTCTCGTGTCAATTCGTGGTTACGTTCACATGTCGTAATTTTGCTAAATAAACCTCAGTAGTGACGATGCTGCTGAAGCTCGTGGACGAGTGTAAACAGA
ACATTTGGGAGTTCCTGGACGCGCAGGAGCTCTGCCGAGTGGCCGGTGTGGCTCACAATGCCGAGCAGGGAGTTTGTGTAGGCCCGATGTGGCAGCAGCA
TTCTCGAGTGCTACTGATTAGGGGGCTGGAATCACTGAAGACCGAGACGGGAGTGCCCGGCTGTGGACTGGCGAGAAGTTTTGGCAGTAGGCATCTATTG
CTGAGAGAGAGTCAGGACCGAGCATCACTCGATGATGGGGGTTACGACGTAATCGACTGGAGACTCTGGTACCGAGATACTCATGTGGTACGTGCTACGT
AATGACAAGATATGTTGAACCTGCTGCTGATCTGTGGTCGTGGTCAGGTATTGCGGACGGGTTCCCGCAATAATACGGAATTTTTTCGAAGGATGAGTTC
CTTGCAAGACCTGAAGACGAAGCGGTCGCATCTGAAGGAGGCGATTCAGAATGTGAAGGCTTCTGCTCATGCTGACAAGCAGTCTCGTCAAGGTCAGATG
AATTGTGTTCGCTGGATGAACAGGACTCATCGACGACTCGCTACGAATATAAACTCGATCCACGCCCAGCATGCGGCGATGTCTAAAGCCGAGTTGGTCG
AGAAGCTGCAACTCGTGGAGAATGCGATTCAAGATATGACGAAAGAACAGTTTTGGCTGCGCAAAGAAGCAATGAGAAGTATGCACAAAGTGAAAACGCA
GCTTGCGGGCGGAACCAAATTGCTGCGGGATGTCGGAGCTCATGCCGATCCGCGCAGCTCAGTATGCAGAACGCCGCATAATATATAATTGGTGTAAGTT
TAACACTACATTTAAGGCTTCGCTTCACAATTTTAGACAAGCGTGGAGGTTCGTTTAGCAATCAAAGCTACATTGGTACTGTCAAATACATTGGTATTTA
TTGCTTGCTATCGGATGACGACGCAGATATCGTGGATCGCATGTTGCGTGCCAACTAATACCCCAAGGCTTATGAGCTGATTGAGGTGGCCAGCGAAGAA
CAGATATGACGACTGGCTCAGGAACTACCCAAAACTACCTTAAACCAACAAGAATGTGTAAGGATTCAACAGCATCCAGACCCAAGGTCGGAGCTGCGAA
TGTTGCAACCATTCTTAAAAGTAGCATCATCATCGAATTAAAACATAGAAACATGTCGAGTACATGCGAAACTGCTGTGGTCGAGTTACAATCACGCAGC
ACGAAAATTCGCATACTAGCGCGTGCCCGTACGAGGGCGGACAAAGCCTTCCTCTTTCGACTCGTCCATATAGTCCTCTTGCTGCGTGCAGATACGCAAG
ATTTCTTTCTTGCTCGACTCCTGCTGGTAGCCTCCAATAAAGAGCTCGTCCAGAATGTAGTACGCCTACAATCAAACACCATTTTATCCAGACTAATCAG
CCTTTTGATGTAGTCCCAGTGCACGTGTGTCTCCTGCGTACCTTGTGGAAGTTAAAGATGATGTCCAGCTCGCACACCTGCGACAACAATAAAAGATTCA
GTCTCCATTGTCATATACTCCCCCCTTTGTCCCTCTCCTTCTATCTAACAGCCACTCGTACATTGCCAAAGTAGCGATCGAGCACTTCCACGAACAGATG
GATCGCCTCCAGAGTAATCAGCTCGTTCTCGTCTTTCGAGATGCACGCGATAAAATAGAGACTCGCGTATCTACAACAAGGACACCGTCAGTCAGCAGAG
GTCCGTCTCGGTGGCATAAAAAGGGCACCCACTATCCCATTTTTAATGACCTTTTGTAAATGATTTTCTTCTCCTTGAACTCGATAAAGTTGCACTGTTT
ATGCGGACGAGAGAGCACGAGCGACGTGATGTCGCGGATCATGCGCGTCTTTTCCTTCAGTGACACGTTCAGGTACCACTTGGCAAGGCGCGTCTTGCCC
TGGCGACTTACGAGAAGAACCGACTCAATCTGTACATACACACAGCGACACGTTATATAACAGAGCAGAGGGAGAGAAGGAAGAAGAAGAAGCGCAGTCG
ACACCTTACCATATCGACAACGATGTACCCAGTGGACACGTCAGATTGATGTTTCGATACACAAACTACACGAGTGTGTGGTGCACATCATAAAAGGTGT
GGCAGACATGAATCACGCTGCACTTCTCAGACTTTATCGTTTGCCCATCAAAATTAAATTCCACCGTCGTCGTCGATGATCATCAAGTGGTTGGCTTCAT
CTCAGGCGAGTCAAGTCACCCGTAACGCATCACTCGCACTCCGCCCTCGCCCTCGTCTGATCCGCACAGGTCTGTACGACAAGCAGCAGCGTCGTGATAT
CATGACCGAGAGCGTGGGACCTGTGGCGCGTCGTATCCGCGAGAAGCTGCTGACTGCCTTTGCGCCGCAACATCTGGACGTTGTGAACGAGAGCTCTATG
CACAATGTACCCAAAGGCTCCGAGACGCACTTTAAGGTGGTCGTCGTTACCGACCAGTTCAATGGGAAGCCGCTCCTTCAACGACATCGTATGGTGAACG
CTGTCCTACAGCAAGAGCTGGATGAGGGCGTGCATGCGCTCAGTATCCTCAGCAAAACGCCCCAGCAGTGGGAAGCCAATGCCGTGGTCAAGGCCTCGCC
CAGCTGTCGCGGTGGCATGGCCGCCGACGAGACCAAGAAGGAGTTTCTGGAGACTTTGAAGGGAAAGGCACAGCACGGAATGGAGTGAGCACGTGATAGA
AATCTGCAGCACAAACAAGCTACTGCGTGTCTTGTTTCAGCACTCTCAGAGTCTGAATGATCCGACTGAATCGACTTCACTTCATCATTTCGCTGCGCTT
CTGTTCCTATCTAGCGGTAACGACGATGTAGCATGCCGTTGAGCAAGACAGAGAGCAACCCGCCGACGACGACACCTAAAATCTCCTCTTTGTGCTCGTC
CATGACGCATAGCAACCTTTGCATCGATGTGGGCAACTTTTTCTTCCAAGAGTTGAAAAAGGGACGTCGCGAAACGCGACAACCAACTTCCTCAGGGATC
GAAATGTCGTGCGACGCGATGTACTGGTAATGCAAACGTGCCAACGCTTCCATCAAGATCCCTTCAATATCAGCGTCTTCCTCCGGTCGCGAGATCAGAC
GTTCTTCCATATCTGTAATCAGAAGCACCTCGTTGAATCGCGAGTGCAGCTCGTTTGCGACCACCACGTGCATCGCATACTTGTCGATCGATTGTTTTGC
CTTTTTACACAAAATATCTCGGTCCGTTTCAAGCTTGAACGACACCACAAACGACTGCGGCGCCCACTTGTGACGCAAAACGCCGAGCATCTTGGGAACT
TGCTGCAGCGTCAAGTGGAGCGGACCTGCTCGTGACTGGATCTTGTGTTCCAGCAAATCTCGATGTGGAATGTAAAAGTCGCTCACAGCTGCTGCCAAGA
GGAACAAAGCACGCTCTTTCCAGGGTGCGACACACGTCGCGATCATTTCCAGGACGAAAAAGTAGTCGTCCACCGACGCAAAAGGCAGCGCCAGTAGCGT
GTTGGCTGTACGCACGTTCTCCATTTTATGAACAGCATCAACCACGTCTTTCTTTGCAGAAGGATCCTCGATCATTAGATGAATCTGTTGCTCGCGCACG
TTCTTACTGTTAATGGGTACATCGACGTATTGCAAAAAATCCACATCCAGCGCCGTACATGTCGCACGTTGTAAGTGTCTCGCAAAGGGAGCGATAGAGC
CAGGACGGTGCACGTAGATCACTGCATATCCAATTGCCAGCAGATACTCGACAGAAGCGGCACCTCTCGAGCCCGTGGAGAAGTTGTCCAGGAATCGCAC
CGTGTTTTGTTCCAGCGGGACAGTCGTGCCCCCCGAAGTCACGATTGCGACGCATTTACCCACGACACGATGATGGTCGAGAAACGCTTCGACGCGCTCG
CGCTGCTCATTGATCCGCTTTGGTGCCACTGTCGTGCGGAAATACTCGTCCGTGAAGTGCTGGTCCTCGATCAAAGTGCTCATAGTGGCACAAATGGGTG
ACTTTTGCAGGTTTGATTGGCGAGTTTTTTACAGCATGGCCAGCCATCGTTTAGAGAGGTTATCAGTTGTCGAGTCGACTATCGGATTGCGTGGGAAAGA
AAGCACCTTTTTGTGAGTGCTTTGTTTGGAAGGAAACTTTATTTACCTTACCGATACCGGTAAAATTGAATTAGACGAGACGCTTTGTCTGCGGACAGAG
GTAGTAAGCTAACATTGGCGGCTGAAAAGATTGTAAGCGCCTTATTACGCCTGACATTATGTTGACGTAATTGACGTTGCTGAACTAGAATTCAATAATA
GATAACTACATTTAAGGCCGGTCTTCTGACGGATGTCAAAGGCTCGTTTGCGAAAAGCGATGAGTCGTAGAAGGCGTCGTTGTACTCCAGATAGTCGAGT
TGATTGAATAGCTCACGGTTTTTTTTTCATCCACGAAGGGTGAGCTACAAGCTGGAAGCACCGCGTTTCTTATTCAACTTCTTACGGCACCGATCACTTT
TGTAGCGTCGGGCCGACTGCCACTTGCAGGAAATGATTAAGACTTGCTAACTTTCCGCGACAGAGAACATGTTAAGCCACGGCCACGAACAACAGAAACT
CCTAGGAGAATCGGGCGGTACATGACTCGGGTCATGCCTACGAATTTGCCAAAAACGAAGCTCGTTCGAAAGTAGGATGTATGCTGCCGTTGCGCAAGCC
AGACACAGATAACAATTTGGATGATATCCAGTCGTACGTTACTCTGGTACAGGAGAAACGTCTTTCGGGCAAAGCGTTCAGTGCACACTACTCAAGCGAT
TGCACTTCTGACAGCCTTTCAAGTACATCATGTAGCTTGTATCGAAGGTCAACCTAAGCATCGATACCAAATACAGGTTCAGATCGGAAGAACCACAGCA
CAACTCTCACGATGCTTTCGCTGGAACTTTTAGCTACGAATTGATCGATGGGCCTTACTCAAGGTAGCCACATGAAAGCTGCCGACGACCATAACTCGTC
ATGGTTCTTCGTGTTAGATGCAATCGCACTTCTTTGTTTTTCTAGTTTTTAATACAAACCAGGTGCTCCCTGTCAAGTCACCAGCGCGATGACCGAGGAT
GATTTGTTGTTGTCCACGGTAACTGTGGAGGTCTTTCACAAGCAGCTCTTCTGCGCTGAAAGTCCCTAATGCGCCGCTCTTCAAATTTTAGTAACCCGAA
TCGCCCCAAGTTAGGCCATTCGTTTGTACAATCAGCAGTAGCAATGTCATTTGGACTATCACCAGACTCTAACATGTCTACCCTTTCCTCGCCAAATATG
GTCAAATTGGCGTAACGTCTGCACCTCATATCGCCAGCTCGCTCGTTTGTAGATCCTTTGGAGAAGCACATCCATTTCATATCAAAGTCATGAACCTCGA
AATTTGTAAAGGTTTCCACCCCGAACACTTCGTGACGTCAAGTACTCGATCGTCCCAGGCCCCCTGGTCAAGTCAGCAGTTCTATGTCGGCAGTGGTGAC
AGCAATAATAAAGTTCCCACAACGCGAACAGAGACCGATTATTGCCCTCACGAATGATGCTTGATCATCGCATACATCGCGTATCAGCTCTAGACTCTCG
CAGCAACAACGAGTCGGGTCCTATAATTCACTATTATCGATTTTAAATCGCGACGGTTTTACTCGCTACCGTCGGGTCTAGCGCCGACCACTTCGCACGA
GTCGGATACACGAACCGATAACACGATATTTCATGTGCAAGGAGCGATGTGTCGCAAGACGACTCTATGCTCTGCAATTTTACGTTACCCAGTCCGAGCG
GACGCTGTGGTTTCTGAACGGTTTCTACCGAAACCCACGCCGGCTGAAGGATCTAAACTAGAGCTACCAAGTATCACTCTACTGCGACTCATTCCCCAAC
TCGCTCGCATTCAACCATCACTTTACTCCAAATCCAACTCAATGAAGTTCCTTAATCCTTTGGTGCTGACTGTCGCGTTTGCTGCCGTCGGTGCCGCTGA
CGAGTTGACAAACTTGTCGCGCCCGATGTTCTTGTCGACGTCAGGCTCGGTGAATCCTTCACCTGAAATGTCAAGCTCGACGGGTTCTTCAGAAGGACCC
AGCCCTTCGGTAAGCGCGAGCACCTCCTCGTCAGCTTCAGCTGCATCATCTGCGAGTAACTCCATGAGCTCATCTGCCTCTACATCTGCATCTGCCTCTA
CTTCCGCCTCTGCTTCCGCCTCTACTTCCGCCTCAGTATCCGGTAGCTCCGGAAGTATCGACGCGAGCAAATCCTCGAGCAGCGACGGCTCCAGTGGCTC
GGAAGACTTGAACATCGATCCCATCCAGTCTGATGGCAGCTCCGGCAGCAGCGCTCCTGGTATGGAAGATACCGATAGCGTCTATGCAAGCGCGTCATTG
GACTCGGGATCGAGCTCGGAAGCGAGCAGCATCCAACGTGTTGCATTCTACACGAGTGCTACGATCGTTCTAGCCGCTACAGCTCTCTTTTAAGACAGAT
TTACGTCGAACAATTGCATAGCTCATAAGCAAGCGACTCCAGTGTAAATAAATACATCACATTCCTTGCCATACTTTCTCTTGCTAGTCACTGCTTGTTT
TCGCCAATCTGCTTCACTTAGATTGGAACCATTTACATACAACTAGCGAAAGTCGATTACCGAATCATGAACGGACGCAACCGTAGCCTATGTAGGATGA
CGGTGGTGACCTCGCTCGTTTCTTCCGTTTCATTCGGTCCAGCATTCGAACAACTACGGTGCTACCAATAAAATGCGTTGCGAAACGGTCGGAAGTTCGT
CTTTGTCCGTTTCGCGCTCCTGCCTTTCGCTACTTGAATCCGGACAAGATGAAAAACGATAAAGGCGCCGTCCAGGTTCTTCTTCATTCGCACATTCGCT
CTCTAGTACTCACACTTGCAACCACCCAGTCTTCTGTTAATCCAAGATGATGAAGATCTTCACCGCCGTCGTCGTTGCCACTGCTATCGCAGGTCAAAAT
GCCGCCATTGCGCAGACAACAACTACCAACGACGAAACAATGGCTCCAGCTCCGGCCCCAGCTACTGGATCCGAACCGATGACATCGAACGAAGACCCGA
TGGTCTCTAACGAAGACCCCATGGCCTCTAACGAAGACCCGATGGCATCGAACGAAGAAATGATGACATCGAACGAAGAAATGATGACATCGAACGAAGG
AACGATGGCTTCAGCTCCAGCTCCTGGAACTGAAATGATGATGGACGACATGACGACGCCAAGTGATCCAAGCACCACCAACGGCGACAGCACAATGTCC
GACGGTGAAGCCATGGACGGCTGGAGTGGTAGTGAGACAATCGACCAAGAGAGTGACATGCTTGGTTTGACAGGCAGCATGGAAGAAGCGGGGTCCGCTG
AAAGTGAGCCCTCTGGTAGCGGCTCTGGAAACGACGCCACCACCGTCGGTGATGAGTCCTCGAGCTCTAGTACCAGTGGAGCGGTCAGCATCCAGTCGGC
CGCGCTGACGGTGTCGACTGCCGTGGTCGGCCTTGCTACTGCTTTCTTCTTCTTCTAAGTGCTCATCTTAAGAGCGTTGTTCACAAACTTGTAGCTCAAT
AAAAACATGATCAACATGATCCCTGAATTTTAATCCCTTGTATGATGCACTCAGATGTTGCCGATGTTCCTAATGACGCGAATGCTGACGAGAAAGCGCC
TCGAAAAGAGACGCCTCAAGCTTGGTCCCTAGCATTCTACGTCCTCGAGTACAAGCGCAAGTCATACCATTCACACCTCGGAAGATGCACTTTCGCCACT
CGGAAGTCTCGGCCTGGTTGTCGCAATGATACTAAACCAGTGTGAAGGGCAGTAGCAACAACTGAAGTCATTTGGTCGCCTCGGCTGAATTACATCCAAA
GAATGCACAACGATGCACTAACGCTGACCACGCTGCTCGAACGTTTCCAACAAATCGATTAAGCCGTTCTACAATGCATTACGCTGATGGAGTGCATAAT
GCTGGAGATTAGTTGTGGTGCCCTAACGCTCACGGACTGTATTCGCTGTCATATATCTAACATTCTGCAATGTGCCCGAAAGTAGGTGTGTCTGGCCTCG
TTGAGAAGTATCACGGAGCTTAGAGTTCACTACGGACTCGAGAGATCGGATTCATCGTATGGTAAAACTGTAGACGGTCAAGGCTTGACTGAGTCCTTTC
TCTTGATGCATACATTCTCCTGGTAAGGAAAAAGAATAGAAAGTGGTACAGCTGGTTAGACCGTCCACGGATCTACTCCCTGCTACTTCCTATCGCAGTA
TGGTATTTCCAATGCCTATCATTATTATTTTTGCTTTGTGACTGTCTCCAAGAATGTGGGCAAGGTGATCATTGTGCAAACGCCGTTTGCCTGGGTCGAA
ACTGTCACAGCAACCAGTCCAGTTCTTGCTTCACACCATCAACAAATCTGTCCTCTCGTCTTGACCTCTTTCTCGTGAGAGCAAGTCAGCAGCAGTCAGT
TCAGGAAAAAGTGAGTGACACAACCTCTTTGTTCCAAAGCCATAGAAAAATGTACAGGAAGACCATCTCCTCTATGCAAAACATTGAGGAATCGATGTCG
CCCTGAAACACGAGACAAAAGAACGACTGGAGGGCGCTCAGTTGTGCTAATGTGTTTTCTACGCCATTCAGGAGACCTTTTATGATGCTCTCCACCTGCA
GGATGCTTGTGACTAGGTTGTCATGATGACAAAAGTGTGCCTGGTTCTTTGCTTGTATGGCATCATTCAACGGACTTCTCCTCATCATAAGACGTAAAAG
AAAAAGAGCTTGCCACCTTCAGTATGACTCATGTTTGTCCGGCTTTACCTTGCCCTGTGAAACGTCCCATGCATACTACCGATTGCTGAAACGTCTATTC
AATCGTTAAGCCAGCTGTGGTTGCATCTGCGATGTCTTTGCAATGCTCAGCATCAAAGGTCGACGGGTGAGGTCTGTTTGCTACAACTTGCGGTATTGAT
CTGATGTCGTATGGCTTTAGCAGACGACAACTGATCCATTTGACTAATTCGTTTGCTCATGCACATGGGAACTAGAGATCAGACGGGTAAAACTACAGCT
TTCCTTGGAAAGGTTTGCAAGGAGAAGTTAGACGAAGCAGACATAGCGGCTTCATCAAGTGCGCCAGCACCGCACCGTAAGCCTGGAGCTCAAAGCCACC
CGGCTTCAGTTAAGCATGCTGGTCTGCAACACTTAC