Description :
From Genome Similarity Track
Location :
Scaffold_11:134651- 136536
Sequence
1885 bases(100 bases per row)
GCTCTTCGTCCACAATGGACTAGAGCGTCTTGGAAACAGACAAGAAGAAACGGTTCTCTGCTCAAGGCTGAGATGCCGTAAAGTATAGCCCGTTTTATGA
TGTTCTGTAGAAACACCATGATGTGTTTCCAGGAGAGGTGCCTAGCTGCCTACCGGCCGATAGGGGCATCAGGCAAGAGATTGACCTGGAACCTGGCACC
AAGTAATGTGTGACCAGGCAATGGCCGTTGCCGAAGGAACAAGTCGATTATTTTGGCGAATTCTTCGACAAGCGAGTTAAGGCAGGACATGTACGTGAGA
GCAAGTCGCCTCACTGCAGTCCGACCTTGTGTGTGCGAAAAGCCACAGGTGGATAGCGCGTGGTTCATGCCTATTACAAGCTGAACACGGCCACCGATCC
GGCGCAAACGCCGATCCCGCGTTGGATTTGTAGGATGGCTACTATCAAGTTCTCATGAGAGATACTGATGTAGCCAAGACGGCAGTGAGCACCCCAAACG
GTGTGCTATAAGAGTGGCTTGTGATGCCACAAGGGTTAAAAAATGCTTCCGCAACATTTAACCGAGTGGTGGATCACGTGATGCGTCAGCACCGTGCCTA
CGCGCTCATTACTTTGACGATGTATTCGTGCATATTAGGGCGGAGGACGGGCTGAGCAAAAAAGAGTCGCACAAGCGTCATTTAGACGCTGTGTTGCAGA
CTCTGGGTGACGCCAATTGTACGTTAGCTTGCAAACGTGCGTAATAGACGTCCCCGAGATACCTGCACTGGGCTGCATCGTGGGTGCACACAGTGGACAA
GCAGACCCAGAAAAGTTAAAGGCTGTCAAGGAATGGCAAGTCCCACGTAATATGAAGGACCTGCGCCAATTCCTTGGGCTCGCTAATTACTTGCATAAAT
ACAGCAAGACTTATGCAAAGCAGACTGAGCCACTGTCTTATCTTTTAAGAAAGGATGCAGCATGGACTTGATCGAAGGAGCAAGAAGTAGCGTTCACACC
AGTGAAGCAATCTCTTGTAGAGGAACCGGTCTTGGCATTGCCAGACGCGGATTAGCTCTTTAGGGTCATCTTCGATGCAAGTAATTTTGCGATCGGCAGC
GCACTAATGCAAAAGGATGAAAACGGTGTTGTTCATGTCATATCGTATCAGTCTCGGCTTTTAAAAGCCGCGGAGATGAATTACCGTGTGCATGACAAGA
AGCTACTTTCAATTATGTATTCCCTTGTAAAGTTTCGTGTGCATTGCTTGGGTATCGAATCATTTGTGGTTTATACGGATTACGCATCACTGCGGACCGC
TATAAATTCACTGCACCTCTTTGAAAAGCATGGCGAGATGGCTTACATTCATGTCTGAATTTAATTTCAAATTTGAATGTAAGTCGGGTACGTCGAATGT
CCTGGTTGACGCGTTATCCCGCAGACCAGACTTTGAGGCAAGACACCAGGAAAGTGTGTCTAGTGCTAAGGAACAAGTTAATTCGTCAACACTAGCATCC
ATGAAGGCCTACCATGTGACGAGATCATTGGCCTCCGATATAAAGAGTGCTGCAGTCAGGACGAACATTGTCGCCTGCTGTTGGGTCATTTTGGTGGGCG
AGAGGTTACACTTTTGTCACACCTGAAATCGAAGTTAAATCACTTTATCTACAGTGATGGTCTGTTAGGCATCAACTGTCACCCTGTGGTCCCTTGAGAA
ACCATGTCCCTCATGACACAAATCTCAAGCTAATGATACTTCACGAGTGCCATGATGCGCCATCTAGTGGGCATCTGGGCCGTGAAAAGACATTCTTACG
AGTGTCAGAAGAATTTTGGTGGCCCCACCTGTATCGGTGGGCAGCAAACTATACTCGCTCTTGTGAAGAGTGTCAGCGCATTAAA