Description :
From Genome Similarity Track
Location :
contig_172:13465- 14484
Transcript NameFunction/comments
g11895.t1hypothetical protein

Sequence
1019 bases(100 bases per row)
GTCGAACAAAGTTGTTCGACGCACCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATC
TTGCTTCTTGCAGTGAGATTGACTCTCGCTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCAACCGCATCACCAGCAGGGCGCCCC
ACACCTGCTGATCCCTCTAGTTTTTTGATTGCCCGTGACGATACCCAGTATCGCCACGACGGCTCTTCGCCGTGTGCACAGGTGCTGTGCACTTGCGAGC
GTAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCCGTCGCACTCGAGAGGTCCATTGGTTCG
GGACCTCCCGACGGCCGTACCACCGGTCGTGGTATCAGCCGCGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCGAGCG
CAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATATGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTC
GTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGGTCGAGGAACTCCGCC
CTCGATCGGAACTCGTTCTGTGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCTTCGTACGTGCTAAAGCAGGTAGGGTCCATGAGTCGGCGTC
CGTCCGCCCAACTCCTTGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGCAATGGCAGTGTCGAC
CTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTGTGGCTGATGGCGACACCGAAGTTCGAGC
AGTGGTTTCACGCTGTTCC