Description :
From Genome Similarity Track
Location :
Scaffold_19:13461- 17934
Transcript NameFunction/comments
Phymu_g1279hypothetical protein

Sequence
4473 bases(100 bases per row)
CGCCGAATCCTTGCACAGACGGGTGTATAGCATGTTGGTATCCGACGCCCACCTACCACGGAATTGGATCGTAAGACCGTCGACTCCCGATCTTAGCGAG
TGCGTACCGAAAGCGGAGGGCATGCCGCCGGATCAGCTAGCAGCTTATTGAATCACCGTCAATAATACCCTGGCTGTAACTGCCCTGGATTTACCGGTGT
GGTCTCTAAACGTCGTCACCGGGAGTTCTACCGATAATGATCCAATTGCCCTCGTAAGAAGTAGGGCACCCAGCACCGGCCAAAGGAACTAGTGTCCTGA
GCGTTGTAGCATGCGCAGCGTCGGAGGTCCGTTCTGGTTGGCTTTCGAACCTCGAAGTTTGAAGCACTGTAGATGCTGCCTCACGGTTTAGCGTGGAGTG
GCCGTATACATCTAGGACGGCTACATCGGATGCCTTCAGTGCGAACCATCGGAACTTATCTACCCCCATAGCGCTTGGTCCGGGGAGATGGAGATGTTTA
GTACATGAAAGCACGTCTTCAGGAGGCGGATTGATACGGGCGCTTTTTGCTGACTGGGTGTGTCAAGTCGCCGGGCATCTTTCAGGTGCATCCGGATCTG
TGGATGGTCGGATGGAAACGATCTGCCTGCCGCGATGAAGAAATGTCGAATCCCCATGAGAGTATTTAGGGTGGGTGAGCTGCGAATTGGACGTCCGGAT
CCATAGCCAAAGCGAAAACCGTGAACCGCGAAGTCCGAAACAAGTTGGAGGCGGTGGGCTGAGTCGAGCCAGTGATGGAACCCTTTCTGTTTTATCCAGC
CGCACCAGAATCGGGACGCGGTGGCCTACTTTGAGAACGTGGTGTCGGTCACTGAATGCTCTCACAAATATCGCGCCATGTCGTCTCCACCGTGTCGTTG
CAGAACGATGGCTGTACCTGGTGCCACGCACGAGTAAGGTCAGTAAATTTTGTGAGTATAGCGCCACCACTCGAGAGACAAGAGCCAGCATCAGCAATGA
CATTGTAAACACCGGCGATATGTGAAGACGAAAAACGCAGGCCGCGCGTGGTTTCGATGTAGGGAAGTAGCCGGGTGAGGGTCTGGGCTCTGGGGTTGCG
GGATGCCATCTTAGACTGCCACGCCACTGCAGACACGTTATCATTTCGGAAATGCACGTGAGTGGATTCGTCTCGTGGGTAGAAGCCCATGACTCGTACC
ACTGGAGGACGGCGAACGCGCAGGCCAGCAGCTCTCTGTAATTGATGCCAAATGCGTACTGCTATTCAGCGTGAGAAGCGGCAATCCGGTCCCGCTCTTT
AGTGTTGAAGTGGTAGATCATGACTCGTTTCCTGAACCTGTCGACGGCGCAAATACCGGTATCCGATACATCCGTTTCGATTGTAATGTCACGCGCTGGG
TGATCCCTAAAGTATGTCAGAGGGACACCGTTCAAAGCGAGGCTCTGGAGGATCAAGTGCCACCAGCGAAGATCGGCTTTCATATCAACATCCATCTTAA
TCGAAGAGGTACCGTTCCTTGCGCCGGAGACGTTGTATGAATGGCCTTGAAGGGCGGACGCAGGTTGCTACGTGGCGGAGCGAGCCCATTCGGGATCGGT
ACTGTGTCCGAGACATGGACGTCGCATGATATGCCTCTTGGACGGCGGTGTGTGCTTTCTTTATTTTTCCGGGTGGAATCGACACAGTGGTAGCTTTGGT
ATCGAACAACAGGCCGATGACTTTTTGACGGGTGCTCCACCCGGTAAATTTGTCGTTGTCAAAAGAGACTGGTCCCAAGGCTGACATCATAGCCATGCGC
AAGGAGTGTTTCACGTCGACGCAATTTGTTCTACGGTCGGCCATTACGCACACGTGATCATCCACCCAGtagtttaaaaaaaaacacctGGATAGCCATT
GTTGCATGTGTTCCCATGGATGTAGGCGATTACACAGGCCACCGCGTAGTGCCCAGGGGGGGCTGTTCAGCCGAATCCTGCGGACATATCAATCACCAGG
GCGTTTTCAGACGGAGTGGTGCCGACAAATTTGTGAGCAGAATGGCTGCAAAAAAACAATAAGTTGCggaacgcagcagccacgttACCGAGCATGACCT
TGATATCGTTGTCCGGGAACCGGGCCGCTTGACACAATATCCTCTTGGCGATAGCATCGCAATGGACGTATTCCGCTGTTGGAATGTCGTCCTGGGCTGA
GAGGTCGTTCACGGAATGGCCGTCAGGAAAGGAAAGATCGTCGATGACCCGATCGAAAATGTCGgggtcttcttccactttgTCGACGGCCCCAAATGGA
CTGAGAAAAGCCTCTGGTCAGAGCTGTAGAATATTGAGGTCAACGACGATGCACTTCCCCAGATCCAGCTCCTTGCGAATGTTTTTCCGGAGCACATTAA
CCCGGGCAATAACGGACGGGTGGTTGTCTGGAGGCGTTGGCTGTGGAGGAAGCGGTTGCGAGGTGGCCACTGTGATGCTTTCATTAGCTGTGAGGACGAA
GTCGTTGATTCGATGATATCCGGCGCAGAACCGCCGCGCAATATTGGGTATAAAGGCTTTGGTCGGGCAGTATTCCGACTCGGATTACCCACGCAAGATC
TCGATGAATTTGGGGAGCGTTACGCGGGAGCGCCAAATGTATTCTGGTAATACGCTCTGCAAAGGTTTGTTGATGCAAAACCGTGGAAGCTCCGGAGCCC
CCTTGCAAACAGGGAATTGTGTCGCTGGTAATGTCAAGCCAACACCAGTAAGAGCCGAAGCAAGCGATTTCCTTCAAATACTCGCTCAAAGTTCTGCCAG
GCGGACGCCATGATGGCGATACCGCGCCGGCATGCTCGGTGTGGGGGCAAGATGTATGCGTCGTGCAGGCTGCCCTTGGCAGGGTGATGTCGCATTGGTG
GACGACCTGAGCGGCGTCGTGTGATTGTACATACGTAGACGAAAGTTGCTGACACTGTCCTTGGCAGTTAGTGCAGTCGCGGACTTCTCTATTGCTGCTC
AGTATCCGGGGCACCCTTGGGTAGAGGTCGACGCCGCTGCGAAAGGAGGAAGACCGGATGGAACGTTCATGCCGGTTAAGGTGGTCTCGGAAGGCCTTAC
ATCAGGAATAGCTAGGCTGTTTTGTGCTGCGTCGGCAAACACTGAGGCGTTGCCGTTGATAGTGTGAATAGTAGCCAAGGCGTTGCCGTCGAGAGTAGCT
GTGATTAAAGTTCCAGCCGTGCCGGCAGATCTTGAGGAGCCCGAGGCGTTGCCGTCGGTCTCGATTGTTAGGGACGGGGCGTTACCGCCGGCTATGGTTG
GAGCCACTCCGTTTGTGTGGGGTGGTACTGTAGTCTGACCGTGGTTGAACGATGGCTCACTGTTAGAGTAGACGGTAAACATGACGGTATTTTTGTCGAA
ATTACCTGAACTGATTAATGACCGAAGCGCCGGTGAGACGGCGGAgcctcagcaacttcaatCGCGGCGTGGTCCGTTGGTGCGGCGCTGGGTACCGTAT
AGCCTGTTAATGTACAGTTGCAGAACGCGAGGCAGCGGGTCCGCCCAACGGTGCGTCCTGAATTAGAACGCACAGCGTTCGCGGGTGCAGCCGAAACACA
TTCCACCACCAAAGTACCGGAGGCAGGGCTCTTTCCCGTCCGAGCGGCGAGGTATGAGCTGTCGGATGTGTTCGGGTATTGCATTCTGGGTACGAGATGG
TGGGCGACGCGTGGTCACGGATGCGCCATCGCGTGGACTTCGGTGGTGAGCTAGTTCCTGTAGGCTCATGATCCACCCGATGGCGTGGAAGTCGATCGCC
GTAACAGCGGCTGCAAAATTCCTCCACCAGTGCTGGGAATCGTCGGCGAGGTGGTGGCCCAGAGCCGATCCAAGGTACATGTTGATATACTGGAGAGTGA
GCGTCACGCGGGCCGGGTCGGTAGCTGAATCGGCACCTTGGTTATCCAGTACAAACTGTCGAAGACGTGCAACCAGTTGATTCATGTGGTAGTACCACAG
TTTGGCTGCGGCCGAGCCGAGGCCAGTCAGCGCCAGAAGAATGTCGTCACACGACTTCCAGTTAGGGCGGGGACTGCGGCGGGGCAGCAGTCAACCCAAA
ATCAGCGGTACAATTGACTTTACTTGAGCCCCGGTTGAGACGTTCGACCACCGAAAGTGGTCGGAAGTGCAGCACCGACAACCCGCGCGACCCTACGCGT
CCGCTGTAGAAGGCCATGAGCACAGTCGGTGCCGTATCAAACGGAATGCAGTCCGTCTCTCGAAGTGAAAGGATAAAGGAcatgggggggggggcgaACG
TACCGTGTTGCTGAAGGAGACTAGGGATACATCCTGTGAGCTGTCGGAATACGCGATGGGCGAGGTGCATAGTCACCCTTCGCACGGGACGGTGCAGTTA
GATAGCTAGTTGAGCGGAGTTCGCTCAGTTGACGAGGCGGCAGCTCGCCGGTGCCACTGGCAGGAAGCGTCCA