Description :
From Genome Similarity Track
Location :
Scaffold_105:134547- 135977
Transcript NameFunction/comments
Phyci_238511hypothetical protein
Phyci_164550Hypothetical protein
Phyci_238493Hypothetical protein

Sequence
1430 bases(100 bases per row)
CAAATGGCCTTCATCCCTCTCTTTGCCGCCAGGCAGGCGCGCCGGCTTTCGTGCACGCAGATTGCTCTTCCGACGCGCTTGTGATATCATGGTTCCTTCC
TTCAGGTGGttgtgccatatatcaaagcacgacgtggctgctccgttgctctcatgtttgaccttgttacaaaggaacacacgagacgctagggagtgct
tcaacaaagtcttcagcttgcaaaatgagcagtagaagtcgtatcaccaccgcgtgcctgaccaggacgcttcagcaccgaacatacttgacaagccctt
tgccgccgcttcAAGGTCTGCCGTTTCTCCACTCATTCGTTTGCACAGGCATGTGAGCGGGTGCATCTCAGCTGGCCTTCCTTGGCGTGGGATCCAGACC
TTGATAGCGCAGTAGTTGAACCCAgtcacttggttggagctggcacagctccaggtgtagttggctcaagaagctgacgggtgataccttatttttgccg
tcgacaatgtggcgagcattgtagatgataaatgcattgataatcgcaaggtctattaggcccagaaacaacgacttgtagtactttttgtagcgtcttg
caagttgcagcaagtacctgtagtattatccacgatacgctttgtatgaaaaaaaatggatatacacgataagagcacttaacgctggaggcgaagctgg
tcgtgcacgtcgaccccacccatggacgtctggtagtctttcacggatctcgggcagatcacttctacttgttcaacagtggcagggtcacgacgaacaa
tcctgtccagctcagcgtttccacctgccgcaaggaaatagacgcctcgattatcccaccaccgtgtaaacttgattcttggaacctgcGTCAGCCCCAC
CAGGTCAAACGCGCCTTTTTCAATCCAATTGGGCCGTTTGTTCGACTCTTTTCGTCCATTCTTCTTCTTCTCAGGCAGGGTAGCTTCGCATAAGCCCTTC
TTgttggtcatgacagtgcccacgctgtaaaatttcatcgtcagtaactgcatggcgagcactacagaagtgtaaaaccgatccgtcacaacaaaacggt
attgtgactgaccggttggtccaaagacttgacgtaggttccgcatgaccgcagcaggcccagacttgtcAATGTGCTGGTCAAGGTATGTTCACCGTTC
AAGAAGCCGAGCATTGCATGCTTTTATTCTCGCTCGAAGTAACGGTCTAGTGATCTGCATTGTATAAATCACATTTATACGGAATGGTACACCACTATAT
AAATGACAATGGCGGATTCcttacctgggagagctccatgcttaaattcaaccagcgcagcatccaaaggtagttgtgcgcactcgcttccttcccacgg
caggtaatatcgacatgaagaccatgcatc