Description :
From Genome Similarity Track
Location :
contig_66:134534- 135987
Transcript NameFunction/comments
g11832.t1XP_009534248.1 hypothetical protein PHYSODRAFT_347716 [Phytophthora sojae

Sequence
1453 bases(100 bases per row)
TTCCTCACGGCGGAGGACCTCAAGATGGCGCTCAACATCTTTTGCTGCGTCTACGGCATTGGTACACTTGGCATGCCCGGCAACTTCTCACGTGCCGGCC
CCGTGCTTGCCGTCGTCGGCATGGCCTTCATGGCCTTCGCCAACGTCTACGCGTCCGTGGCCATCTGTCGCGTCATGCTGCTGGCGCCCAAGAGCGTCAA
AACCTACAGCGACCTGGGCGAGTGGTGCATGGGCAAGTGGGGCCGTTGGCTCTCGGTCATCTCGCAGATGGCCTCGTGCCTGCTTGTGCCGTGCGTGTTC
CTTGTGTTGGGCGGCACCCTGCTCGACGGCCTCTTCCCAGACGCCTTCAGCACCACCTACTGGATCTGCTTCATGGCGCTCCTGTGCCTGCCCGTTTGCC
TCATCCCGACGCTCAAGGAAGGTGCTGGGGTCGCTTTCGCCGGTTGCGCGGGCACGATCATCGCCGATGTTATTGGCGTAGCCGTCGTCATGTACGGCAT
GCGCGGCCACCCGCCTGTGCCGTCGCCCGATATCAAGTTCTCGCAGGTCGCGGGCATGTTCGGCAACCTGTCGCTCGCGTACAACGCGGGTATTGTAATT
CCGGCCCTACAGCGCCAGCACAGTGAGCCGACACGCATGCCCCGCGTGGTGTTTGTCACCATGGGCTTCATCTCGTGCCTGTTCTTGATCCTGGCCAGCA
CGGCGTACTCGGCCGTGGGCTGCCAGATCACGGGCAACCTGCTCTACTCCATCTACCCGGACTCGACGAGCGGCCTCACCACGCTGGGCTTCAAGTCGAA
CTGGGGCACCGTCGTCATGGCCTACTTCTTCATGCAGCTGCACATTACGATCGCCTTCTCCGTCATCCTGAACCCGGCCTTCTACCTTGCCGAGCGCCTG
GTCCTCAAGATGCACCAGAAGAAGGAGGACGACGTCGAGAACGCTCTCACCTATGCTGCCGCCTCGTACGCCGCCGCTAACACACCCGCCAAGGACGCTG
TCAGCGGCGACGACCGCCGCTCATCCAAGATGTCGTACATCTCGAACGCTGACGCCGAGAACCCGTACTATGACGACGTCGAGGCGGAGGCTGCCGAGTA
CCGCGGCTCCAACGCGGTCAAGTACGTGATCCTTCGTGTTACCATCATCGTCGTGCTGGTGATCCTCTCGATCATCCTGAAGGACCACTTCTCCGACCTG
GTGGACTTCGTGGGCGCCTCGTGCATCACGCTCATCAGTATCCTGTTGCCCATTATCTTCCTGCTCAAGAAGCTGTGGCACGAGATCCCGATGTACGAGA
AGATCCCGGCGCTGATCGTCGTCATCGTGTGCGGCTTCTTGGGCTGCTACGTGACCTACACGTCCGGCAAGACGCTGTTCGCGCCGACCGACTCGGACAC
GGACTTCCCGTACTGCGACAGCGAGTACGAGAATGAGGTGTACTACAACTACA