Description :
From Genome Similarity Track
Location :
Scaffold_172:13452- 22555
Transcript NameFunction/comments
g6219.t1hypothetical protein
g6220.t1hypothetical protein
g6221.t1XP_009524446.1 hypothetical protein PHYSODRAFT_329641 [Phytophthora sojae
g6222.t1hypothetical protein

Sequence
9103 bases(100 bases per row)
AACTCCTGCACGCGCTTGACCGCATCCATCGTCGACGTCACGTTTGCTATTCACCCCCAAGTACGCAAACCGGATGTAGCCATGTCACTTTTACGAGTGC
AGTTGTAGTGACCGTCAGAGCAATCATGACTTCGCAGGCCACGAGACTCGAGAGCCTCTTCCTGCTCGTGCGAGGTACACAACAGTCAACAGACCGAACT
TCTACTTGCAACAGCTGCCTGTGTGCTTCCTCTATCTAATGCGGTGCATTTCGTGTTGTTTGGACAGACGGAAGCAGCGCGCAGATCCGCGAGAACGCGG
CCGAGAAGCTGGGCGAAGTGGCTGCGCGCTCTCCGGAGTTCTGCGCCTCGATTCTGCAGCAGCTGCGCCCACTGATAGTGCACTCGGAATGGGACATCCG
TGTGGCTGCATCCAAGTGTCTCGATGTGGTGGCCAGATCCCTACATCGTGAGGACGGGAACGTCGCGGATCTCTTCGCGTTGGTCTCCCGTACGTGAACG
GCGTAGAAATGATGCAATAGAGTCGACGCATTAACTTGTTATTTATATTGCAGTTGGCAGTCACGAAGCTTCCAGTGTGGCGCTGAATCTCCAGACGGTG
GATATCAAGAAGGTGGTGCATGAAGGCGCGCCGTTGCTGCGGAGTGGAGGAGAGGTGAGTTAACTGCTGCCTTTAAACAGGTGATTGAAACTAACTGAGA
ACGTGTTGTTCTACGTAGGAATACCAATACGCGACGAATCTGACGGAGGAAGAACGACGTGTTCATGCGGCGAGGCAGCGACGTCTATTGTTGCGGCGTC
TTAGTGGAGCGGGAGGACCTATTTGGAAAACCCGAGAGGACTCACTTACCAAGCAGCTGCTTCCCAGACTCAACAGAGATCGTACGTGTTGGAGTGGAGG
TCTTTTGTGCGTGTTTACTGATTGGTAGCGATGACTGCCGTACGGGTGTGGTTACCTGCAGATGCACAGGAAATCGCTGATGACATTGAGGCGAGCGAAG
AGCAACCCAACGTTGGTGAGAACCCTGCCAAAGGTATCAATCGGAAGCAAGCGAGTGAAATGTTATCGATTTCAACAAGATCAAAACGTCAGCTAGCTGA
TGGTGCAGCTGAGTTTGGGAGCAAAGACAAACGGGCAAAAGTAGATCACAACGGCGATGCAAATGATGCGGACATGAACTTACCAGTTGGGACGAGCTCT
GACGAGCAATTGGACGAGTCGGAATCACAGACCAAGGGTTCGATTGTCGCAAGCTTGGTCTCGGATCTTTTTGAGAGCATGTTTGATTCCAAGTGGGAAG
TTCGGCATGGTGCACTCTTGTCGTTGCGGGAAATGTTATTAGCTGCCCATTTCACCGCTGCAGTTGAAGCAGTCCGACCCGCGACGGACGAGAGCATGCA
GCGAGGCTTCGTGGACAAGTGGCTGGAAGAATGCCTAATACGGTGTATGTGTGTACTTGCTTTGGATCAATTTGTGGATTACTCGGCGGACGGGTCGATC
TCTCCCGTTCGCGAGGTTTGCTCGCAGGTTTTCGGCATTTTGCTTGGAAGTCTTTCCAGCCAAGATACACTTGTCGGGTATTTACAAGTGGTGCGTACAC
TGTTTAATGGATCGACATGGCAGGCTTGCCATGGTGGCCTGCTTGGACTGAAATATCTTGTTCGAGCTCATAGCAGTCACGCCCAAGCGCTAATTCCTCT
TTTCTTTAACGATATCGTGGCAGCATTCTCTCAGCTCGATTCGGAGGAGGATGTTCTAGTTCTGGCCGCAGAAATGTTCACAGATTTTGTCCTATACTTG
GATCAGGTTGAAAGCATAAACATCACGAAGGCTGCGCTGTTGTTGTGGGGATCTCTGAAGTTTAACGAAAAGGCTGGCCTGGTTACTGCCAGTATAGTCC
AAGCACTAAATGCCTGGTACAATCATTCTCCAGTCGCAGAGCTCTTGCAAAGTGACAGTGCAGTCAGGTCAGCGCTTTGGGAGAATTTGTCGTACACAAT
CCCGATGCTCCATCACCACTCGCAATCTGTTCGAGCGTCCAGTGCAACATGTGTAGCGGCCATCTTTTTAGGGGAGTCTTTATTCTTGAGGGAAAACTCG
GTTAGCTTTGCTCATTTTTTTCTGCCGCATTTGCTGCTTCAAATAATTCTGGAAATGAACGAGTCCGTCCAGCAAAGCTTGCTTGCTGCCTGGAAAAAGG
TAGTGAGCAGTCTGTCTACCAACGAGCTGCTGATGACTGTAATTGCTGGAAAAATTCCATTGTGGATGAAACTGTTGTGGTCTACGGACGAAATCTATTG
TCTAAATGTTGAAATGGTGAACTCTGACGGCACTGTATCCGGTAGTGTCGTTAGCGATCCTGCCGGCCGGATAATACGAGACAATATGTCTTCTCGTGTG
GCTTTCGGAGAGGCGATCGGTTTTGCTATTTCCCATGTGCCTCTTTCCAGCGCGTGTATGACTGAATTAGTAGAGCTTGTCTGCGAGGGTCTGTGTGGTA
GCTCCGGTGAACAGCAGTGCGGAGTTCTCGTAGCCCTGTCAAGATGGGGTTTCTTTGAAAAACAACTGAGACAGGAAAGTCCAGAGGAACAAGCCCGGCG
AGCTCGGCACTTGCAAGATACAATTGGGCCCTTTCTGAGCTCGTTCGCTGGAAATCATTGGAGGACACTTCAGCCTGATGCCCTGAGCGAAGAAAAATTA
GTGCTCTATAGCGAGCAAGCTGGATCGCTGAAACGTGTTATGCAGATGGAAGCTCGAATTATTGAGATATTCTCCTCTGTGGGTATTGCGCTCCAGCCCT
CAGAAAGATCGGGCTCGTCATCTACAGCGGAAATTTCACGCCAGATCGCTGAGCACATTGCTCTTTTTCCCTACGAGAAGTTGCAAGACCATCCGAACGA
ATACGAATTGGCTCATTTCAAGCGGCAAGACCTCTTTCTTGCTGATGATCTCGTGCAGCAAAGTTTCTCTCGCTGTTATCACCGAATACAAGGTCTTGGT
AGCAGTGCACTCTGCGAAATACTGCCAATCCCCAAAAAGAGTGGGTTTCTAGTCAAAGCACTCATGAGTTCGATCAAAGAAGAAGATGATTCAGCATTCC
GCACGATTTCATCACAAACGGTTGCAGCCTTTGTGGTCGATCAAGCACAAGCCCAAAAGAAGTGCGTCGCGAAAATCATTTCGAACCTCTGCAACAGCGC
GGCGGCATTGGTAGGCGTATCGGGTGGCCCTTTGGATAACATTATTGGATTCAGTAGTTCGCCGGAGAACCCGAGTGATTCTGTTTCTCCTGGTGTTTTC
AAAAAGACAAAGATCCGAGCTGATGGGGCTGAGGCTGTGCTGCGCAAAATCTGCAACTACGCAGGAGATTCTCTTTTCGATGTCTGTCACGCATTGGAGG
ATGCCATTTCTAAGGCTTGGAACCAACCAAACGTAGACGAGCCGACAATTCAACGGTGCATGTATTTGATCGTCTTAGTGGCACCGCATGTGAAGAGCAG
CGCAATGACAACATGTTTGTCATGGCTTTGTCAACTTGCACAACTGACACAGAAGCCATTTGTTGAAAATCAAACGCGAGGCATCGTGGCTCATGCCATT
GCTATTATTTGCAAGTATGCTCAAGGACATCATCGCAAAAACGCGATGCTCGTCGTGTATGAATCCATCTTCGTGATATTTTCAAACACTGGTGGCGCTG
ACGTCTTAAAATCGGAAGCTCTAGAAGGCGCTGTGATGGTGCTCGACCGCATTGTCCGCTCGCTTGGAGCGGAGTTGACACCGTATGTTCCCAGCTTGGT
ACACTATGCGATGAAAACCATGAGCTCGCAATTCAAACTTGTTCGAACGTTTGCTGCCGGGGTGTTTGCGGACTTGGTCCCGTTGATTCCACTTCAAATG
GATCTTGAGCTTCATAAATCTGACCAGCTACTTCCAGTCTCGCTGAGGACGATTGTGAATCAGAATGCTGTTTCACGTAGCTTCCTGGAGAGCTTCACGG
AAGGGAAGGCTGTTCAGCATACCAATGTGAAGCCCTGGCTTGCTCCAGAGACCTCTTTGCGCGTATACCAGCAGCATGGCGTAGACTGGCTATGCTTCAT
GGCCAGGAACAATCTTCATGGGATCCTCGCCGATGATATGGGCCTCGGAAAGACACTCCAAACGCTTTCTGCCATGGCTGCAACACTAGCAATGACATCT
ACAGCCCAAAGCAAACGTCCAGCGAGGCCTTGTCTCGTTGTATGCCCACCGATTATCGTGCATCACTGGATCCAAGAAGCCAAGAAATACATTCCAGGAT
ACTTCGCATCTGTCATCGACTACTCAGTCCCAGCAAGTGACCGAAAAGTTTTGGGTCACGGCAAAAATATCGTGATATCTGATCACGGCACGACTTTGAT
CGTGACTACATACTCGATCCTGCGGACAGACATCAACCGCTTGGGAGATATTGACTACTCTTTTGTGGTGTTGGACGAAGCACATTTGATTCGGAATCCA
TCGACAGCGTTATTCCGTGCTGTATCGAACCTTCACGCATCACATCGTGTGGCCTTGAGTGGAACGCCGCTGCAGAATAACGTCACAGACCTGTGGGCTC
TGTTCGAGTTCCTAATGCCTGGATACTTAGGCGACTTTACTTTATTCCGTCGCGAGTTTGTCCTTCCAATCACAAAGTCAAAAGAGCGCAATGCAACGTC
AAAGCAAAAGGAGCTCGCAGCGATTGCCATCACAAAACTGCACCAAAAGGTTCTGCCATTTATACTGCGACGAACGAAAGACCAGGTGCTGGAAGAGCTT
CCACCGAAAATCATCTCGAACGTGCTACTGCCGTTAACTTCGCTGCAGAAACGTTTGTACTCGCTGGCGTCGTCATCTGAGAGCGATCCCACAAGCTCTG
TGGCATCTTCTCGGTCTACGAAGGTGGCCGAGCCGAAACCATTGACGAACGTGCTAACAAATCTTCAATTACTGCGCAAGATTTGTGTACATCCAGCGCT
CGTTGCTGACAACGCAATCTCTTTGGGGCTTAATACGAAGGAAACGGGGGCCCTGCTTGACTGGAAAAGCTCAGGAAAGATGACTGGATTGCGCGATCTA
TTGGTTGAGTGCTGCGATATTGCAGCATGGACTCAGGAAGGTCGCCAAGGACCTGCAACTGAAGGTGATGACGATAGCAATTTTTCTCCTCATCGATGCC
TGGTGTTTGCCCACCTGCAGAAGACGCTCGATCTCACCGAGGAAATGATGCGGGACGCATTACCTGGCGTAACTTATCGACGCCTCGATGGACAAACACC
TCACGCCAAGCGTGCAGACATTGTACAGCACTTCAATGCCGATCCGTCAATTGACGTCTTGCTGCTGACTACGTCAGTGGGCGGTTTAGGACTCACCCTT
ACTGGCGCGGACACGGTGATCTTCATCGAGCACTCGTGGAACCCCTTTGTTGATCTGCAGGCGATGGATCGTGCGCATCGCATTGGACAAAAGCGAACCG
TGCGGGTATTCCGACTAATCATGGAGAAGTCACTTGAGGAACATATTCTGAATCTGCAAGAGTTCAAAGAACAAGTAGCTGCTACGGTTGTGCAGAAGAG
TGATGCTCAGAGCAGCATGAATACGAACACGAAAGGAGTCCTCAACTTGCTGCAGACGTCCTCATCAGCGGTGGCTGCCAAGGAGCTTCGCGCGTCAGTT
ACAGCAAAAACGGCAGGTCAAGATGATCCAAGTGTAGCAGCAGCCCTTCCACAGGGAGCCCAAGAGCTGCTAGACCAGATTGGTGAGCTATGGGATGAGT
CCCAATACGACTCGTTAGCGTTTCCTGAGCCCATCCACGAGTAACCATGCGCATAACGATTCAGACTCAATGATGGCTCTACAAAAATATCTCCTATGTA
TTGGATCATCGCTGGGATCTCCAGAATCTGGAGTCCAGGTGAGCAGACCACGCCGAGTTGGTTTACTGGGCATCAATAAGGCTTTCGACGTCGAGCTGGA
TTATATCCGCGTCACAGTCCTATGGCAGAAAAGCAAGGAGGGGAGACAACGTGAGCGAACCTTTACGCGTAATAGCACTTGCACAGCTGTACAACATACC
AAAATTGACGCGACGTTGGGGTTGGTCCGACCACGGTCACCGTGCACGAACTCTTTAACGTAGGTTCCTGCGGATGTGGTGAGGCGCAACATCATGTAAT
GCTTGTTCAGCACCTCACACTTGGCAGCATGGATAATCTTCGGCCTCGTCATCAGGGTTCGGCGATGCAGCACGCGAATAGGAGTTTGCTGCTGAATGGT
GAGGTCTTGAATTGCATCAATCTTCGCAACGGACTCGGGGGTCAATTCACCTTCCGACCACACAACGCAGCTGATAATGGAAGCAAATGCGAGTTTGTCA
GTCTAACCTGAGGTAGTAGTTTGTCCCAAGGTAAAACACTCACCAGTAGGTTTTCTTCTTTGAGTCTGCTCCTGCCTGCAGCCCAGCGAAATAGTCCTTC
GTCGAGCTCTTAACCTGGACAATCTCGACAGCACCATTGTTTGCGGCATTCACAGCCTTCTGAATTCCATCGTACTCTGATTGATTCAGGTACGCTTTCT
TGGCGTCTGCAGGCAAAACAAATACGGTTGAGATAGGCCAAGTCTAATACCGCTACATAAACGTAAAGTTGCAGCTTACCCAAAATCTCCAAGATGAAAG
GCCTTCCGTTTCCTAGCATGCGCACGTCGACATCTTCACGACCTGCTGTGTGAAACTTGTAGCCTGCACCCTTGAAGAATGGCAGGGCGATGTCACCGAT
GCACTCTTCCACGGAGGATTCGCCCATTCGCTCGCCATCAAGAACCCACGGGGTCTGGCTGAGTCCACGCTGGAACTTCAGATATCTTCCCTGCATGTAC
ACCGGATCGCGTTCAAACGTGGCAACAGCGTGCGGGGCAGTAGTGATCCGAGTCGGTGGACTCTTAATAGTCTCGGGCATGGACGAAAGCGTCCCCAACG
CGCGGGAAACTGCACCGAAACCATCAAAGACCGGGGGAGGGCCACGACCGCGCTTCTTCGTTTCTAGTTGTTTCTGCCGAAGAGGAAGCAGCGAACACAC
GTGAGTTATTGCACCCAAGCACCAGACAACGTGCTCACCATACCCTGATCGACGGAATCTGGCGCACGTCGTCGGCAGATTCGTCATGGTTGATGTCGAT
CAGCACTGCAAACTCGCTGCCGTTCGCGCACTCAGCCTGGTTGAGCATCTTCGCGATAAAAGGCGCCAACAAAGACTATTCACGACATTCCCAACCGCAA
TAGACGTAAGTTCATACCATCGATCGCAAACGCCCGTAGTTGTTTGTACCTTGAGCACATCTTTCATATCGAACGGCGTTTTGCGCGGGAAGTCCACCAC
ATCCGAGCGCAAGAAGTGCAGCAGCGAGTACTCGCGCAGAAGCACCACACTGGGCAACTTGATGTTGAGTGCGAAGGCCTTGACGTCGTAGTCGCTTTTC
TCTGCCATTTGCTTCAGGTCTTCTAGGATCTTCGAATGGAACGCCCCGTTCAAGACGCCCACGCAGCATGTACAGCCTAGAGAAATAACACACAAATTCA
ATTGCAAATGGTGAATAAATTGCAACAAAACCCACAACAGCCTCATTTACACATGCTAACGAACCGGAAACTTCCTGCGGCTCGAAACCCGAGACGCCAC
TCTCCTTGGCAAGCTCATGCACCGCATCCACCAGCTTCTGCTCCGAGCATCTGCAGCGGCAAACATCATCAAAGAAGCGCGCAGGGTCAGTCAGTCGTGT
GTCACTGTGCAGCTGGGCACATCATGGTGATCTCCGGCCCCACACGCACGTGTAAATGTCCAAGTCTTCGACGTAGGCGAAGCGCAGGCAGCAGCGCACA
CAGACGCCGAGCTCTCTCGCGCGCAAAAGTCCCGTGGCGGACAGCAGGCCGCCACGCAGCGCACCCGAGACGTCCATGGCGATGCTGCTCCAGTCAAGTG
TTGATGTTGATCGTCAACAGAGAGCAGGGACTTTCGACCAATTGGCGACGTGGTATCGACCCGTTTTCGACCAATTGTGAAGGTGAGCTCGCCACGTTTA
CGACGCATACAAATCGCAAGTGTGACTCACGCGCTCCCGCTCTCGGTCACAGTCGCCGATCGCCGTAGCGGCATCGCAAGGGGGGAAAGCCCAGTCGCAG
TCAGTCTCGGACGTGGCGGACAGAAGAAAGCAATCGCAGCCATGCCGAGCTTCTGCCCCAAGTGAGTTCGTCTGCCTCTAGTCTGCAGTTATATGCCAAT
GGGAGCTAACGAACGCGCTGTGCCGTGACCAGATGCGGGGACTTTGTGGAAGCGGACGCTTGCGAGAAGTGCGGCGAGAAGGCGGTGCGTGACGTTGGTT
TAGGCGCGGTTTTAGGCGCAGGTGCTGACGTTGTAGCTGCAGGTGACGACCCAAGAGAATCCGTGGAGGGCGGCGTCCAAGGTTCCCGGCGGAGAGCCCA
TGAGCGTTCCCGCGGTGCCCACGGCCTTCACCGCCGCCGCGCGTATCAAAATGATGGGGTGCGTCCTCATTAGCAGTCTTAGAGACTTTTGACTGCTATC
AGTGCAGCGACTGACGCCGTGTGTTTGATTCCCTCGCGTCGTGCCTATGTGTGTGCGTGCAGGGTGCAGCCCCTGCCGGAGCCCGCGCGCAAAGAGCAGG
CGGAGGCACGCTTCAACTTCGTGCCGCAAGATCCAAGCACGCAGCTGGCGCTGGCCAAGGGCGATGAGGTGGATGTCGTGCGCAAGGACAGCGACGGCTG
GTGGTTCGTCATCAAGGACGGCGAGAAGGGCCTCGTGCCGGGCTCGTACCTGCACATCGAGAACCCCATTATCCCCGTCACGGATGCGGCGATCCTCGCG
GCACGTGAGACCTCCAATCAGCGGTTCATGGAGATGCAGCAAAGCTCGGGAGCAACTGGACAGGGTGCCGAGCCGGGAGTGGAATACCAGTCGCCGCTGG
GACTCGAAGCGCTCGCGATCGCAGACTCGTGCGCGCCCAAGCCGCCCAATGGGCCTGCCCGCGCTGATGCCAAGTCTGGCGGCACCGAGTTTAAGCCGGG
CGA