Description :
From Genome Similarity Track
Location :
Scaffold_1:13452- 14554
Sequence
1102 bases(100 bases per row)
gaagctgatcggcgatcttcaaggcccagtgatcaagccagtcaatccggtagatcaagcggcggcgatcagcatgctaaaggaagcggggattttggct
gggaacttcaacgccgaggaaccgctcgaacttgaccttcccacacttgaaggatccaccaaacacttggtgaagctgctcacgccattggtaggcgccg
tcgttttgaccgtcgatggggactgacgacgacatagtccgggtcacctcacttctccttcacgtctgcgaagacattgcgagggtgtcgtaggcgggat
ccgatatctcgttcgagctaagcaggatgacgcttggaccagccggagcagccatgttctctgaaatttatttcagagtatatcaacgatcatactttcc
gctcaaaactccataaactgaaatatcagaaaacaagaataacactcgtggctcaaaacagaactctaatatctaataagtcttcaagaaaacccaaaca
acccaggaaaatgttgttccaaggttctactgtcgcaataaattaacttcaagttatagactgtagagatatcgatagtatcacaacaaaaagcgaactg
cattagttcatatctagcgagaactgaatcaaccaggccctcattgtttgcacgatattcgttgaaatttacgctcgaattataaattacggtaatgaat
cgcgaatcacccactgttcgcgcaacattatgattattcggctgggtgagtacatgcacccagcgtagaaagaaataatagaaagaaataaaaggataaa
tacgattctggcaactatcacaagtaaaagtttaaattaacagactacaacccaagcaatacttggaatcatttatctctttcaatgatagctgcaacat
cacttagaggcactcaatacccgttctcatcttcaaaccgaacttcgtgataacggtcgtatatttctcttcatcctcatccgccgcggtttgttggtca
atagtagttgcgtgctgagcaacacacacatcagcgagctttgtattgaattgacaggtctcctcgcgaaagacacccaagccggtaaagtgtacaattc
ga