Description :
From Genome Similarity Track
Location :
Scaffold_2484:1345- 3338
Transcript NameFunction/comments
Phypl_g15124hypothetical protein

Sequence
1993 bases(100 bases per row)
TTGCCCACTATCGTCGACGAACTTGACGTCGGATCTTCGAATTGCGTACGACTGGACCTTCGATCCTTGACCTAGATACTCCGATCGTCTAAGAAGAAAG
AAGAAACCCAGAACCGAAGCCCCCCAAATGACTCGGTGCTGGGAGTCTGAGAAatcaaggtgctggtgcaggcACTTGAGAATATCGGTTGTGACCGGGG
ACTTGGGCTTACTCGGTGGATCCGGTCGCCGCATTCCCGTGATTGCGAGTTGGTGGCCTAGCAAGAGCCCGACGTTATAGCCAAGCATTCGCCTATGATG
CCATGCAATATGGCTGATTTTTGAGAGCACGGTGGAGGCAGCATTTCCTGATCCGGACTGATCCCATCCGTAGCGCCAGCAATATGTGGCGAAAAGCGCA
GGTTGATAGGGGTGCTTTCGAGGTTCTTCTGGTAACCACTTTGAAAACCGCAGCCATGAACACCAAGTACACCACTGTGACCACGTACTCGCATATTtgg
tcgtggacgtcgaGGCCAATGACTTGGACTGAAGCGATTCGAGAAGTTGGTGTAAAGTTTCCTGCATTCCTGCGGCACTGGCGTCTGCATCCAACACGTA
GAAAAATTAGTCCATCGTGCTCGGTAAGGTTCGGTCCAAGCTCGTGAAGCAGCATCGGCCATCCAATTTGTCGACCCGGGAACATGGTCGGCCGATACTC
CAAGATTGAAAAATGCTTCTGCCAGCCCAATCGCTCGATTAATTTCTTGACTAAACGTATTGTCGGAGTGTAATCGATTACACCAGCTcaccgctgctgc
attgTCGGTCCAGCATTGGACATGGATTGTGGGACCGAGCGATTGCTGGTTCCATTTCGAGCCCCATGTCCATATCGCGAGAGCAATGCTAAGGTGTTCC
CGGACGTTGATCGCAAAACCGTCCCCATCACCACCAACTGGGTTAATAAGAGTTGACTCATCCGAATCGAACTTAATCTGAATGAAGGAATCGCATGCTG
GATCTAGCACTGCTAACCCGAGGTTAGACGCGTCCATGTTGAGCTCGACGTGTGGGTTCGGTAATTCTCCAAACATAGCATGCGGTATTTCTGCAAGACA
TCCATGATTCAAAATATGCTGAAACCAAACCAGATCTGCTTTCGCACCCTCTGAGAGTTGGACTCTACCAAACCGAGGAGCAGATGTACACTGGGACTGC
AACCTTTGATAAAAGGGTTTAGCGGTGCGCAAGCAGTTGGCAACGTGCCTAagcgagcccagcagcttgtagaGTTCGGTTTTTGAGGACGTGCCACGTT
TCCGCATAGCTATGACTCGATCTCGAGCTTTGGCAATTTTTCTTCAGGTATGGATACCGTGTGCCGTTCGGTGTTCCATCGCAGACCCAGCGCCACTATT
TCAGTGCTCCACTCTGAGAACTTAGCCTCGTTGATTGAGCGAGGTCCTAATACAGCCAGCATCGCGTGGCGTAATGTTGCTTCAGCGAGTTCCAACCGGT
CATCAACATCACGTTCTACCAAAATATGGTCATCTACCCACTCGTAAAGGAAGAAAGGGTCCGCGTCGATTGAGTCCGAAACTGATGCTGGTGAATTGCT
CCCCATTAGCCAGGATATTGCTCGACCAAAGAGAGCGTAGCACGGTGGTGACCCTGACCACCCAAATGGAGCCGCCATGTCGACCACGAGAATACCCAGT
TCTTTCACATGGGCTGCCATTCGGAACACTTCGTTTGCTCGGGTCCGTAGATGGCGAAACGCGCTGTTTACGTCGCCCTTGAGGATACAAATTCGTCTAG
TGTGATCATCTTTGGCTAGTTGTTCGATGCGTCGAGCGATAATTGTCACCGATTCATACCTGACCTTTGGCACGGACTCAGCCACAAACGCAGTGTTCAC
AGAATCATCCGTTGGAAATGATAAGTCATGAATAGTGCGCACTTCTTCTAACGGGTCGGCACCTTTCTTCTCAACAGCACCGAGAGGGCTGCA