Description :
From Genome Similarity Track
Location :
Scaffold_3404:1345- 2551
Sequence
1206 bases(100 bases per row)
CCTTCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCCGCAAGACACTATAGAGTAATGCTCCACAGCTCCGATCTG
CCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATACACCAGAAATTCGCGGTAAATCCGTCCGTATCGAGTTCGCTTCCCTGACCACATATCGGT
GATCTTCTCGACTTCGAACTCGTCGTCTTCGAGATCCACATTCCAACTATCTTCCGGTAGGAGGACTTCGTCGAAATCCACCCGGTCGGATTCATCCACC
GAAAGACGGATCTGCGGCCGATCCGCGTATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCCA
GCTTTACCGCATGTTCTCCAATCTTCTCGCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGCGGGCGTATCCTTCTTTCACTCGATCCAAATA
AAGCCACACCTGCGATCCCACTCGGATTTGATGTGGACGGGCATCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGTCGTTCGCTCACC
TGGGATCTAGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTACATACTGGAATGGCCACTTCTA
GGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGGGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTGCGTA
CTCATCCTAATCCCTCTGATCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGATTGTCTGTACCATGCGCTCGGCCGATCCGTTAGCTTGGGGGCGA
TATGCCATGGTTGCCCGCTGTCTCTGCCCCAGGATCCGGTTGAAAGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATTTCGC
TAGCTCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCAGCAATGGTCTGCGCAGTTCTAGACGCACTAGCTTTGGCTATCACGTATCCGGTAAACAG
GTCAACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTGGAAAGGGTAAGTAGCTGGACATC
CCAGGG