Description :
From Genome Similarity Track
Location :
Scaffold_1:1344980- 1350682
Transcript NameFunction/comments
Phyin_T30-4PITG_00214Putative uncharacterized protein
Phyin_T30-4PITG_00215Calmodulin-binding transcription activator%2C putative
Phyin_T30-4PITG_00216Putative uncharacterized protein

Sequence
5702 bases(100 bases per row)
ACTGTTGTAGGCACGAGGTTGCATTGGCACAGTCACTCGCAAAGCGACCGCATCAACGTCGACAAGGTGCTGGACCAAGTGCGTGCCTTTTGCACTCGAG
CAGTCACGTACTCGGATGGCGGAATTCTTATTGCGGTGGGGCTACCCGAAGCCGGCATTATCACAGCCGCTCCTGGAGAGGCACCCTCGTCAAGCGCCTT
TATTGACTCTGTGCGCGAGTTTATGAGTAAACTGAATAGCGAGGTGGCGGCAGGGACCCTCGCCGGTAAGGTGGAAATTATCCCGATGCTTCATTGGGGC
AAATTCGTGCCGGCCCTGAACGCGTTGATTGGAACGGCCGCTGATCACTTCCCTGCGGCCGACACTCTAATTCTACAGTCACTGGAGATCGACGTGGATG
CAACCAGTGTAGCCTCCCTGCGCTCACACTTCGATGTCACGCAGGACCTTGTGGTTGGCGCGGTACTGCCTGGCCATGATTTTCGGCCCGATCCTTCGAG
CCAACCAGTCGAGTTGAGCGGTTTGACATCGCCGTGGAACACGCTTGCACTCTGGAATCTGGAGCAACTTACAAAGGTGGGGTTTGCCCTCATGGGAGAT
GCGTTGCGTCTCGAAGCTGACGGGATTGGCTCGGCTGCTGGCATCGAAGAAGTCGCCACCATCGCCATGTACCAACAACTCTACGCCAGCGGTTCGTCAC
CTACAACAGCAAAACTGGTGCGCGTACCTAGCATCGCGTGGCAAGTGAATGGACTGCAAGACCCCAAGCGTCTGGAGTGGCACAAGAAAAAAATGGAGAG
CAAGCAACAGCGCGCAGCCGCGCAGCTTGCTCACTTCGGTGGCGTGGCTTCCGGCTGCGTTTATCACTTGGAGGCATGAACAGGAAAACCGTAGAACTAG
CTCAGAAGCGTTACAACCTGGCAGGTGGCTGATTTCAAGTGTCCTGAGCGTTTGGCGTGGTATTTGATGAAAATGCGGAGCAAGAAGCAGCGCACAGCGG
CGCAAATGGCTCGTTCTGGCGGCAGCCTTTACTTCACAATGGGGCATACTAGAAGCGACAATGAACAGCTTTAAGACAAGCAAAGGTTTATCTGTTAGTT
TGCATTGAAAATTTCAGTTTGAGGCATTTGATCACGTGCAGTCAGCACAATTAATTAAAATGTAAAAATCAAACGCGTCGTGCGGTTAACAAACTTCGTT
GACATTAAAAAAGAAACTGTTCGAATGTCCAGCAGCATATTTGCAGGATACAGCATTCTGCAACCAATGATTATACATGTATGTTTATCCTGGATATCAT
TGAAAAGCTCACAGCCCCACAGGATAACTTTGCAGCTCCTGTCTCAATTGATCACTCCATCTCATTGATCTTTTTGTTCACGCTCAAATCTGCGACACTG
CGATAGACAGTATTTCAACAAGTACGGTACTATCCGGCGGCAGACGACGTTACGGCGGCCAGCGGCGAATGGACTCAGGCGATGGCATCCAAACACGCGC
AGCCTCTCTGCGCCAGGAGGCAACTCGGCGGTGGCTCGTAAAAGATGAGCTGGTGTTCCTCTTGCAGCACTACAAGCTGGTGGGCGTGCCAATTCTTCAC
TCGCTGCAGCTACGGCCGCCTAGTAGGTCCCATCGTCAGGTGGACTCTACGGCACGTATGTTAACACTTGTATTACTGTCAATAGGCGGCACTTTACTGT
TCTACAACACGCTCAAGATCTCGGACTACAAGAAGGATGGATGGCATTGGCAGAAGCGCAAGGACAAAAGTGGACGAGTGCGTGAAGACCGCGCCAAGCT
CGTGATCAACCGAGAAGTCATCATCTTAGGGACATACGTGCACTCGGCAGACACTTCTGTATGATGTTAGAAGTTTGCTTCAATTCTAGACACTCTGGCT
AATCTTTCGTATCTACAGACATTCCACAGGAGAATTTACTCAGTGCGCGACTCCAACGACAGTATCGTCCTTGTCCACTACTTCGACGAAGTCAACAAGG
AGCCTGTGCTCCGTCAATTTTCCTCAACGTCTAGTAAAAGCCGTCAAAACACCAACAAAGGGGTAAAACGATCGCTGCCAGTTGCTCTAGGTAGCAATAC
TTCCACGATTCTGATGCCGTCATTCCAGCAACTCAGTCCACCAAAGCCAATACCATCGGAAGAAACGGTAGATTCCATCATGAAAAGTACGCAGATATTC
TCTCTTCATTATCGTAGAGCACCCAACTCTTAACCCGTGTATTTGTTATCTTCGATGCAGACTGTTTCGAGATGGACTTCGAGCCTCAAACTGCATTATA
CCAGACTTCTTCGCTCAGTATGTCGGATGCGGATCTGCTACTATTAAAAGACAGCACGATGGACTGTCTCAGTGCCGACGATTTGTTCAAAGATCTGGCG
TCGCCAGAAAAATATACCAGCGGTTTGAGTGGCCAACAGACCTTCGAACTAGTCGAAATTTCAGACTTTTCGCCAGACTGGGACTTCGGAGATGGCGGGG
CCAAAATTCTCATCTGCCTGGCAGCCAAGCTACCTAAAGGAATGGCTCAAGACCCGATGAAGTTGTTTGTGCAGTTTGGTGCGAAACGAGTCCGCGCCGA
GAAAGTATCAGACACGGTATTGCGCTGCACAGGTGGGCTTTACATTTTTTTCAAGCTGTGTATGTTGAAACTAATCACGTACTTGCGTGTGTATTATTTG
TACAGCTCCTAGCTCTTTGGAAGTTGGGGGCGTGGATATGTTTGTGTGCCATTGCGGGGGATCACAGGAGTGCATACAGCTGTCACATAAAAAGCAGTTC
ACCTATCGCAGTCATTATCAAGTGTCGCCTTCATTAATTGGAGACATTGCAAGAGATAAACGCCTCTGTGAAGCTCGGTCGATAGACCCTTTGGATCTTA
CAGTACCCAGTTCCTCGCATTATACATTCGGCACCGGCAAGAGAGGCAGATCACCGACCGTTCTATCTCATTGTGCAGTCATGAAACGATCAGAGGACAA
ATTTACAGGATCACTCAGAAATCTCTCGACATTTGTCGAGTCAGATTGTAAGCTATCGGTATTTCTGCATTTTTCCTCATTTCTTACGCCTTGTTACTAT
TTGCTTACTCAGTGGACGAGCGGCAATGCAAGATTCGAGTCGTCGAGCGGTTGTCTGAGTTTCACCATGCTATCCGCACAAAAACAACAGAGCCTGCACC
CAAAGCGGCGTTGTCCTTAACTGGAAGTAGTAATGGTGACGGGAACATTCCTCCACCAAGAGAAGAGAACGCCTCTTTACCGGTGACACTACCGACGTCG
GGTTCACCGACTAGTCAAGTGCAGCCAATAGCTCAATCAAATGTCAAAGCAGAGCCTCCAGATGAATCGACTTCCTCCAGTGAGATATCGACTGCGCTGG
ATGACTGCACAATCGAGACTCTGAGCGACAACGATTTAGAGCAGCTCTCAGAAAAACTACTCGAGCGTGTGGTGCGTCAGCTTATCACAGTCGCACATAC
AAGCGAGGAGCTGCTGGAGGAGCTCAATTCCCTGGACGAGACTGGTTTGAGCTTATTGCACTACGTGAGTTTCTACAACTACTCGCAGTTGGTGCCGGTG
CTGGTTGCACATGGCGCACATATCAACCAGCAAAGTACGCAAGGCCAGACAGCACTTCATCTAGCAGCAGGATGCGGCCACGATGAAGTAGTCGATGTGC
TACTGCAATCTGGAGCGGACCTTCAAGTACGTGACTTTGACGGCCTTACTGCTGCTGATCGCGCTGAAAAGTCAGGCCACGCACACGTTGCTGCAAAACT
GCACCGTCACATGGGTGATGAGCCGAATGACTTGGGTGCAGTTGACGAGATATATGGCTTTGGAGGATCACCGATGGAGATTGACGATGCCCCGACACCG
TACACGGATGCTGGGGATATGGGCCTTTTAGCAGAAAATGACGACGTGATGTCCAATGTCCGTCCACCGCGCTCTCACTCGAACAGCTGCGAGAGTCCGT
CGGAGTCGAACTTATCGTCGAAGGCGACATCTTACGTAAGTGATCGATTGCCAAGAGATATTGACGTGTTGTGTTGCTTACTGAAAATGCAAAATGTTTC
GCAGGTGGGAGAGAATCAAGAGCACAATCGGAAGCTGCTGCTTGGAGCTTTCTCGACGATGAGTTTGCACGATAAATGCGCGCTTTCGCTGACGATTTCC
CGAGACTCTGGGGGTCACGTGTCCAGACGTCGGGAAAGTAGTGTCGGAGAAAATATTCCAATCAACTCTCCCAGTAGCAGCACGGGAACATCGGTGGGCT
TCGGTTCATCTCCTGCTAGTATGGTTGGCATGGATGCCAATCTTGTCGGTGGACGCTTAGTGTTGGCCGGAAATGAGAACGACTCGGATGTTCAGAGCAT
GATTGCCGAAGACGAGGAAGGCTTAAACAAACTCCAGGCAGCAATGGAACTAATGGGTCCGGAAGAAAGACAGTCACTGGAAGACGAGGTGAAGGTATTG
CAGCACGGCATCCGAGCGTGGTTGCTCAAGCGGAATTGCAAGAACATGCGTGAGACGACCAAACAGCTCCGCGAAGCCACGCAGAGCATTGAGGACCAGC
AGAAGCAGCAAGAAGCACTATCAGAACGTGAGCGTGCCGCTGTGACCGTCCAGGCAGCGACGCGCAGCATGTTGGCACGACGTAGTTTCCTGCAGACAAG
GCACGTCACAATTAAGTTCCAAGCCGCCACGCGAGGTGTCCTTTGTCGCAAGAACTTTGCCCGTATGAAAGCGCATGCTCTAGCATCGTTGGTGATCCAA
CGCAATGTCCGCGAGTGGTGGAACAAGCAACCTGCTGCAACTCGCATCGATAAAGAAATAGACGACCAAGAAAAAGATTCACAAGAGGAGAAAGCACCCA
TCCCAGAAGATGCATATGAAGCGCAACACAGCTTGTAAAACGCGCCACTAACCCCAGCAGAGTATCATAGTCCAACACAACTGCACACCTCCATCTTGTT
CTATTTTGTCGCTTTCTCGGTATAACGACGACTTTAGCCTGCCATTGGAAACTCGTGCTAAAAATCTTAGTCCATAGTCTCAGCTCCTTCGTCTGTGTAT
CGTCGGAAGCCCGGGATGGGCGGCGTCCAGGTGGCAATTCCGCGCTCCTCCGGCGCCGGAGATACATCGATCTCCAGTGCTTCAGTCTGCAGCTCTGCGG
GCAGTGCGTTGATAGCCTCCCACTTGAGGTCAATCTTGGTCTGCAGGTCGCGCATGAGGTGGTTGTGCTCGATGGTGCTCATCCTGTTAAACAGGCGGCC
AATCTCCTGGTGGCGCTGCTTCTCCTCCTCTGTCCACTCCTCCCTGCAAAAAATGCACATCCGATATTAAGTACATTATAATTGTTGTATGGCACTAAAG
CGCAGCATACGCGTCGGGGTACTGGCCCTTGATGGCACGCAGCATTTGCTCGAAGTTGGAATCATCGCCACCCTTCTTGTCCTTCTTTTTCTTCTTGTCC
TTTTTGGCCGCAAATCCGCGGACGCTCGACGAAGTAGCTGCCGCATCGGCCAGTGCACAGGTGATGGCACGCTTGGCGCCCACCGCAGTCACGCTACGCA
GAAGCAGAGCCATGTCAACCTGTTCAGAGTCTCTCGTCCACAAAGTGCCTCAATAGAGTGCTAAGTACGAAGCTGTGTACATAACTGTTACTTCGAAATA
TT