Description :
From Genome Similarity Track
Location :
Scaffold_86:134468- 136232
Transcript NameFunction/comments
Phyra_83320Hypothetical protein

Sequence
1764 bases(100 bases per row)
AGACCATGCAACTGCGCTTCCCACTGCCGGCGGGTTACTTCGCCAAGTTCGATCTGCTGCCCACGGAGGTGCAGAGCTACCGGACGCTGGCGAGCGACAT
CGTCCGTGAGACGAAGCGGGACTTGGACCATTACGTCAAGGACGGACGCAACTTGATCGACGCGCACACGTGGAAGCTGGCCAAGTCCAAGGAACGATTG
CACTGCTACCGGAAACGCAGTACGCAAAACGCGGCGCACCAGCTCGGACTGTACGGTACCGAGCCGTCGAATGGAGGCTCGTCCGCTTCGAGCGGTAATG
ATTCGTACGGATACTCAGCGCGGTCGCGTCCGTCGATGAGCGTCACGAGCTCTCACAGTCGTTCCGGACACGAAGACATGGGGCATCTGTCCGTGTCGAC
GCGGTCTTCAGATGACGGCGAACCGAGCCGCAAGAGCATTCAGCCGATGGTGATCGGCTACGGCATCGTGGATGGCTCCGTGGACGACCTGGTCTACGGA
CTCTACCAGTCCACGACCGACGAGATGAAGACTCTCTCCGCCTTCCTCGGAGACGACTCGCTCATCGACTGTGCCGCGTTGAAAACGATTCGTCAGACTC
GGTCGTCATACCTCGGCCTCAAGTGGAAGCTGTCCCGCACGGTGGGAGGCAATCGTGACTGTTGTTACATGGAGTACGTGGGTGTGTCGGAAGACGCTAA
CGGCCAACGCTTTGGCTACCACGTGCTGGAGTCCGTTGCGGTCCGCAATTGCCCGCACTTTGATGACAACTCGATCGTGCGCACCAACTTGTCCTTCTGC
TTCATCTTCCGACCGGGCAAGCTCGCTGACCAGGTAGAGGTGTTTATGGAGGGTGCGTACGATTCTTCGGCCGACGCGCTCACGGCTGGCGGAGTGGGCG
ACTACCGCAGCGCGATGGACATGTTGTTTAACCTTCCGACGTCGCTCGTCGGAGCCGAGGCCAAGAAAATCTCGGCAATGGTGGCTAAGCAGTCAGGTGC
GCTGCGTGGAGCAAGCAGCAAGAACCAGAGCGGCAACCACTGCTCCATCTGCCGCGCCAAGTCGGGCCTGTTGTCTTCCCACACAAACTGCCAGACGTGT
GGCGCTGTCATTTGCAGCAAGTGCCGCATTCGCAAGGTGACGTTTTCACGCCGAGGCAAGATCAAAGTGTCGTGCTGCAAGATGTGTATGGTCATGGTGA
AGGATCAGTCGCCGTTCGCGGGAGAGCAGCTTGAGCAGCAGCCTGTGAAGCCGAAGAAGGCGTCAAGGGACGATGGCCGCAGCAGGAACGGCAGCAACAG
CAGCAGCAGCAACACTAGACTGGACGTGATCAACGCGTCCGTGTCCACTATGTCGCTCACGGACTCGGAATACTCCGAGTCCTGGCAGTCCAGCTCGGCG
TCTTCGCTGCAGTCCGACCTTGATGACAGTTTCTACAACTCGACCGGGCCTAGCAGTGCCATCGTCTCAAGTGACAGAAAGATGCCGGCGCTGATGGAGG
GCGAGCTCCGTCCGCCACCTCCCAGTTATTACCAGAGCGAACAGCAGCGTCAGTACGAGCAACAACAGTATCAGCAGCAGCAGTTCCTGATCCGACAGCG
AATGAAGCAGAGTACCGACCCCAAAATGCCTCCCATGCCAAGGCAGCGACAGCCCGCCACTCGCGAAGGAATGTACAACCAAATGCTAGAGCTGCAGATG
CAGGCCGAGCGGGCCTACAACTTGACCAACCAGAACGCCACCATGATGAACACGAGGCGATAGC