Description :
From Genome Similarity Track
Location :
Scaffold_716:13446- 16774
Transcript NameFunction/comments
g15092.t1hypothetical protein
g15093.t1ABG66535.1 reverse transcriptase, partial [Phytophthora ramorum

Sequence
3328 bases(100 bases per row)
GCCCTGCTGGTGATGCGGTCGAGCGTGTCGACATCGGACACGCTGCATTGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGA
CAACCCGACCCTTGTCATCTTGAAGGTAAGCTCGAAGAGAGAGAGGTCTCTTCGTGCTCTAGTGGACTGTGGTGCGTCGAACAACTTTGTTCGACTGTAG
AGCCTTCCAAGGCTTGACTTCGAAGAGGTGAAAATACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCG
TACGCGTGCGCTTCTCATATCAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTCGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGCAA
GCCACGGCATGATCAGCTGATCGACTGGACGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCACAGCA
CATGCACCACGTGGTGCATGCAGCCCTCCACTAGATACAGCGCGGAATGCGGCTGTCTCGGATCACCCCGAGCGAACAACAACCAATGCAAGAGTCGTTG
GATGGAACTGTGAACCGAAACAGCAAGGCCTGATTTAATTGGATTCGAGAGGGTCTCGAAGCGTCCGGGGCGACGCGGTCGTGTCGACAGGTAATGTCGA
CACACAATTGGTCGAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGACGCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAA
CGTCCCGCACCGGAAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGATACGCGATCAAGCCGGGCTTGAACGCGTGCGCCCACGGGAAG
AACCCGCCGGCGAATACAAGGAACATCTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGACCGGCGCAAGCG
AGCAAAGCTGCGCAAGTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACATTGAGTGTC
TTGACGCGTACGAGTATTGGTCTCCAATACAAGAAGGTGAGGCTGGATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGA
AGCGTTTCGCTCGCGACCTGCGCGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGAAGTGTGAAGCAGAAGAGCTGAATCAGCT
CATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGACCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTC
TTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGTGAACGAAGT
ATTGCGTGGCCACTGCCGCGTGAGCAAATCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAAAGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACA
GCGCGCCTACGTTCTGTGTCAAGAAGCCACCGGGCGGGTGGCGCATCGTTCATGCTTACAACAAGCTGAACGACGCGACGGTACCGGCACAGACGCCGAT
ACCTCGAAATGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGT
GATATTCCTCTCACAGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTAATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGT
GCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGATGACGTGTTCATTCACAGCCGGGCTGTGAATGGGAAATCGGATGTGGA
GATGCATACAGAGCATCTCCGCTAGTTGCTTGAGCTCATGCAAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCC
GTACTTGGGTGTCTCGTAGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCATACGTAAAGGAACTGC
GGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAAATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATG
GGAATGGACTGCTGATTGTCAGCAGGCCTTTGAAGCAGTCAAGCATGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCAC
GTTGTGTGCGATGCATCCGATTTTGCGATCGGATGCGCAGTGATGTGTGGTGAAGTGCTCTCCGGAAATGTGAGCGGAAAAGGACGAAGTAATCGCAGTG
TCTGAGAAGTGACAGAGAGACGGGTCTGGTCGACAGATCTGGACCAAGGGGACAATACTGCTAGGAAATGGAGCAGAAAGTACGACATGAGGGGTGGGTC
CCACAACGGAGGCCTGATCCGGCGGGTAATCCGGACGAGCACCCATGCCCAGATCAAGATCCGGGCCTAGGGGGGATACATCGCGATCTGTGAAGCTACC
AGCCAGGGAAGCAGTGCTGGGTAAGGAACCGTGGAGTGCCGATTGGGGAAGTGACGGCGCACCTGGATCAAGCGTCACCGAGATAGCAGATGCCTTGGAA
GCCGACCAGATCGGGATCTGGCCTCACAGTAAGTTTTGCCCAGATCACGATCTGGCCCCGTGGGGAAGCAGAGGCGGATCCCGGATCTTGGATCTCGCCC
AGATCACGATCTGGCTCGGTAATGAGGCGGGGGCGGATCTCGGATCTTGGATCCGGCCCGACTGTGAAGCATGGGACGGTGAGGAGCCGCAATCAGGCGA
TTACATCAAGGTAGCCGGTGCAGACGACGACGGGGAGGATAGTGAGATGGTAGAAAAGACGCATAGTCAGTCGTACACCGTAGATGAGTGGATGCAGGAT
AGGACAAAGTATGGGATAGGACTTAACCATAAATCAGAATCGAATTTGCCCTGAACTACAAGAGTGCTTCGCCTCCGCCAAGAAACGGGAACTACATTGG
CCCTACAAGGTGCTGGCAAGACAAGGAGTAGCTGATCTAGTGGTTGTGTAAACCTGGATAATATATTGGCCAGATCTTACCTACTCTAGTGATCTATTAT
CAAGTGCAGATCCCAGATCCGACGGAGT