Description :
From Genome Similarity Track
Location :
Scaffold_70:134404- 135927
Transcript NameFunction/comments
Aphas_H257_15677Hypothetical protein
Aphas_H257_15678acyltransferase 3

Sequence
1523 bases(100 bases per row)
AAATTCAAAACCTGTTTTTATGTCATAACTCCTGTAAAAATGCTCCAATTGCGATCAAATCGGTGGCAAAATCAAGGTTTTGATTGGCTCTATCGTTTGG
CGCTTCAAAACCAACAAATATTGACAGAGTTACGGCGCGAAAACTGCGCGCGTGTCTGCAACAAAGTTCGGCATATTGCAAAATGCGACCTAACGAAAAG
CCAAACCTCACCGACGCCGACAGAGTGTCCATCGTCCAACACCTCCTTGCTCGCATGGTCGGTGGCAAACTGCCTCATGGCGCAATCGCTCTGGTTGCTG
CTGACTTTGCTGTGCATCGCTGCACTGTGCAGCGGATCTGGAAACGTGCTTCAGTGGATCTGAATGACCCTCGCCGTCCGTGCAAGGACCCAACGTCACG
GATGAAGACGCGCGTTGGGCGAAAGGCTGTCCATCACTCTGTTGCCGATCGGTTGTGGGCAATCCCCAAGAATCGACGTACGACGTTCCGGTCAATTGCA
GAAGTACTTACTTTACAGTTAGCATGCAAACTCGCTCGGATAACAATACCGGTACTATTGTGGTAATACGGTAATATATATTGAGTGTTAAAACCAGACT
TCGGGCGCCGATTTTAGGGAAGTTCTTTAAAATTGGGATTCTGCACACCTTATATCGCAGCCTATTTTTAGCTTGTCCCAGGTTTCATTCAGCAGGCCTG
GTTATATTTTCATGGCGGCATCGACGACTTGGTCGATGACGCCGAGGTACTTGTGCGTGTACGTCCGCGTCAAGTGGTTGGTGTCCTTCATGACGGGTCG
TCCGAGGTCGTCCACCACCCCACACGAGTCGTTCCAGCAGTAGTTGTCCGAGTAGTCTATCAAAGTGGCGTTGGCAGCCGCGGTGGCGTTCTCGATCAGC
CCCAGCAGCCACTTGTGTTTGAGTCGAAATGCGGCCTTGGACACGGGACTCACGTCGCCGACATCGTTGCCGCTGAGCATGTGATACGGGTTGAACTGTT
CACCTTCCACGTTGATGGTGGCTACAAACACCTTGATGCCCAGCCCTGTCAACTTGGTCATGTCTTGCTGGAACTTGTTCATGATGGTCACCACGTCCTT
GGGGCGCTGGTACGTGCACTTGTCTTGGTATCCCGCCACGCAGCACTTTGGTGTACCCGCAACGCTCCGGTCCGAGTCCAATCCCCCAGGGCGGAGGAAC
TGTGGCCAGTTCATCGAGTGCAGAAACACTTTCGGACGAACTCGCTCCACCACTGCCATGACGATATCGTAGTGTTCTTGGCACGTCAAGGCGGGCGTCG
CGTCTAATGATTTGAACACGACCGTGGGGAAGTTGGACCGGTTGCGGGCGCCGTGTCTGTCTTCGAACGACCGCAGAAACCGCGGCTTGACCTGGTTCGC
GTGCGAGTCGCCGTAGGCAAATATGAGGTTTGGTTGGCCAGGGTTCATCATCATGGTCGCGTGGGAGGTGGTGCCGAAGGGGGCGTCGGCTGGCGCGGGC
GAAAAGCCCACGTCCACATTAAA