Description :
From Genome Similarity Track
Location :
Scaffold_640:1344- 2718
Transcript NameFunction/comments
Phyta_totarag9865hypothetical protein

Sequence
1374 bases(100 bases per row)
CCACGTTCAACGCCACCTACCACAAGACCAACAAGACCAGCAccccagctccacgacgctcTCACGCACTTGTTGCGGTTGACACATTTAGTGTTGTGTC
GTTAGCAGAATCGGCATCGACAGGAGgttcgctgttgctgcgagTCCTGATACACCTTAGGACGGCGGGTTCCCCGATCAGAATGTCAATCCCCTCTACC
CCATCGCGGCTTCCTCCTGGGCGAATGTGAATGTAGCAGGAGTCTAAGCTCCGACCGGATGGTCACTTAGACATCCAGCCCTTCTTGAGTAGCTTTTTCC
ACACCTCCTTGAATAACCCGGTTCCTCTGATACAGCTAGCTGTGTCTGCAGGACAGTGATCGACGGAGGATCGCGTGAGACGGCAGAGCTTTCTTGTGTT
GGTCGGTAGAACGTCGTGCATGCGCTTCACTCCGcgaggaagcggaagcggtTCAGCCATTTCCCGCCTGCTTCGAAGTGAGCTCGGATGGAGTGTTGGA
GCGTGGTGTCTGCACGTGAAATTTATAAAGGTTATGTACTTTAGCAAATGGACTATTAGATACATTTTATGCTCATTGAAATTTAGAGACTATAAACTTA
GGAAGTATTCACAGCTCATGCGCGCCACATATGGGCGGCAAATCGTGGTATGCTTATTTTGGCTTTCAAAAACAAACTTCAGCATTAATGCATACGTCAA
CGTGTAGTCGTTATAGGTACTCTATTAGACCATATTAAAACGAGCAAACATGCAACAAACAAATGAGCGAACTGGTAGATAAATAGTCTAATCGAATAGA
CGTCCTGGCGGACGTCACACGAACTATTTTAACAATGCTAATGTGCACCAGAGGCAATCAATGTATACTTATCGATCTACCTGAGACGAACTACGCAGTC
AACTGCGTAGGAAGCCCCGCGTGCGGACCAGAGTTGCGCCGGCTTTCGCGCCACTACATTAGATAATGGCGCGAAAGCCGCCGCACCGCGGCGGGCGAGC
ATCATCATGACACCAGCGTTGGTACATCATCGTTCAGAAAATGAACTTAGCCAGTAAGTGATTGGTAAAATATTGTTTATTACCGCGTAAATTACCACTT
CGGTACGTTGTACCATTAGGTATTGTCCAACCAGCGGCGCTCAACACATTACAAAGCATCAAGTATCAATATTAGCCAATTAAAATACAATCTAAAAGGA
CGCAAAATGCTCCCTTTTGGAGTGTTCCCTATCAGAAGAAAATGTATCACGTATGATTTGTACACGTGTCCTGTCCCTATCAACCGCTAAAAGGGCGCAt
tttgcgcccttttagaCTGAATTTACCAAACTTTGTATACTATAGTTTACCCCCGTGGCtcacgaaagggttaa