Description :
From Genome Similarity Track
Location :
Scaffold_836:1344- 2389
Sequence
1045 bases(100 bases per row)
CCTGGTTCTGGCAAATGATCCTCTGTCAAAGAGAACGAGGCATCTAAAGCACAGTTGCATTTAAAGTCAGCATCATTTCAGACCAAATTGGGCTTACCAA
CGAAGCAATCATATCAGTACAAAAGAAAATCTGAGTGGTGAGGCCTTTTCGAGCTGCAAACCTTTCGGTCCACAACTCTAGCTCAGCTGCGACGCCGTGC
AGGGGGGATCACGATGCTCAAAGACAGCTAGTGCACTACATGGTAGCATCAAAAGCAAAATACAACGTACACGCTCTTACCGTGGAAGTCTGAACAGTTC
GATGTTGGCGTGTCTTGGTAGAATGCAGCATGAGGTTGGCAATGACAACCTTACACACTAAGAGCAGCACCTAAGAGCATGCACCTCAATAACGTGCACC
TCAATAACGTGCACATCAGGAAGCACGTGCTGCATCTGGTGTAGTTGTAGCACGCAGCTCCATGGATCCAAGCCACAAACTTGGAGAGGCATCATTCTCC
TACAAGTTAAACAGAGTAGACCTGTTCCGTCCGTCCGTTCCGTCCGTCCAGTCCGTCCGTCCGTCCGTCCGTCCGTCTGTCCGTCATTCCGTACGCACCT
CGAGCGTAACGCAAATCCGGATTTTCCGTTGGCTATAAATAGCTGCCGAGCGCAGCGAAGGCGGCCCTCCCATTCGCCAATATTATGATTCGAGCCCTCT
CATTGGCTATTTAGTGGAGCCTCTGCGCGATTGGCTATTATAATGCGTAGAGTGGACTACACCACATCGGAATTAGCGGACTGAAATCACTGATGCTGAT
TGGACAAAATAAACCGCCTTTCAACAACTTTTCTTTTCATTTCCATTTTCAAAACGACGCTCCGGCGACGGACCAGCTCGACGGAGGACCGGGCGCGATA
GCTTCGCAGGCAGGTCATCCCCGCCGCAGGCAGGGTAGGTATAGATTAATCCTATTTAATTCTAATACATAACGATTTCGGGAGTGCCGCCTGTTGCGGA
TAACTGGTACCTTCAGGGCAGTCGAGGGGTAACCGTGCGTGTTAG