Description :
From Genome Similarity Track
Location :
Scaffold_6:13437- 16531
Transcript NameFunction/comments
Physo_128847hypothetical protein

Sequence
3094 bases(100 bases per row)
CCTCCTCGGACGATACGCTGTACTCTGACACGGAGTCGACGCTTCTCGCCTTGAATGAGGACGATGAAGACTCCACGAGAGACGACGAAGCCATTGCGCT
CTTGATCTTGGGCAGCATGAAGCTCGACTTCCGTCGCAGTCGCTCGATGTCGGTCTCAGCTAAAGAGGCAGAAGCTGCTGCAGCTCCGGAGATGGCTGCA
GCCGACGCGGCCTCTTCGGCTGCCGTAGCTCGAGAGAACAAAGCGTGAGAGAGCAACCGCTTGCGCTTCTGCCAGTTCTGCCACGACAGGAACCACGATC
CGTCACTCACGCGGCTGAACTCGACGCTGTTCAACGCCACCAGTACAGTGTACACCCCTTCCTGGGGGAAAGCTGGGGCTTGGCACAATATTCGCTCGGA
AGACACGAACTTGGCCACCACGTCGACGTACGATGCGGCCTGCTCCGGTACAGCGGGTGATGATGTCTCGCTGTTAGCAACTGGACGTTTGTCGAGAAAA
CTCGCGCTCTTGACTGGTGACAACCCCTGCGTTTGAGGGGCCTTTTGAGATGCGTTTTCCTCTTCGATTCGAGGAGTGGCTTCCTGCTGCTGCGGCTCCG
TGTAGAGCTGGAACCGCACGATGATTTTACCAGTGTCGATGAATCCACGACCCTCAATTACGACGGCAAAGCCCCCGTAAACCGGTCCATCCATAGGCGA
GACCAAGTTCACTGTGGGGATTTCTCGGTACACATTCAAAGACAGTGGCGAACCGGTGAACTATCAAACACAAAATACTCAAGTTGGTCAGTAAAACTAT
GCCTTAGAACGAACGAACGAGCCAAACCCACAAAAGTGTTGAAAACATACCGCGTTGTGTTTCCCACCCAGCCAAATGTCAACGAGGATGGGGGACGCCA
TCGCTGTGGCTGAATGAGCGGGTGATTTTTCTCGTCCGAGCGATGATGAGGCTTGCAGTATTTCTCTCGGAATCGGGCAGCGCACCTGGCCGTTCTCACA
GATTCCACGGATAACCTTCCGGCCGCGACTGCTGCTGAAAGACACCTGGACACTGGCAGCTTCGTGTTGTCCTCGGTTGTTGTCTTCCATGGAGGTTGCA
GAGATCGTAGCGGTGAGGTTAATGCCTCTCAGCTCGAGCTCCAACGTCGTAGTGGCCGACACCCAGCTCGGAAAGAGCTCCGTTAATCGTGGGGACTGGA
ACACACGCAGTTCACCGGGACACTGCACAAACTCGACGCCGTTCATGGCCACCGCAACCCGTACGATAACTCCTCTCGGGAAATCAGGCACGCTGCACTC
CATGCGTGTACTGGACACGACAATAAGTCGCGCTGTGCGGACTTCCGGATCTACGGCTTGGGTGGTAAAGCGCGCTGTAAACAGAAAACATTGTAAGACA
CGTTAATGCTGAAATCCACACGAAACCCAAAACTTACCAATTGCGATGCCCGTGTTGGTGAAGTTTGTGCCGTCAAACGTCAGGTGGGAGGTGTAAACCC
CATCCGTAGGCCGCACGCGTGTGATTTTAGGAGCCAAGTAGACACGGATCTGCGGTACGAGCAAGTAGTTCCCCTGTCTGGTTGAAGTAACCAGTCGAGT
CGGGGAGAACCGACCAGGTTGCTTCGCTCCGGTTGAATCAGTCGTCCTAGTTCGTGACAGTTTAATTACCTTCTTCCAGTCCACGACGTACTGTCCACTG
ACCAAAGCCACCGCACTCTCCGACGCATTCTGCGCGGTTCTCCTCGGGCTCTTCCTTGGAGGTTCCTCAACCATATTTTCATCGCTCTCTTCAATGCGTT
CATCAGTTCTGGGGGTTGATGCCACAGGCTCGGAGACTAGCGCGGTTGCTTCGAGTTTCGTAAGCTGCTTGGGGAGTGCGATGCTGTCGAAGTCCGTACC
GTTCACGGACACGTACACGTTCACATAGGATGACTCTGTCGCCAAGTCCAGTAGTGGCGGCGTAGTACAGACCAGACTGGTGCTGGAGCGGAACTTGGCC
TCCACGAGGACGGTGCGATCACTGCGGATCGTCTGAGTGACGCCTTCATCCGAGAGTACCGCGAAGGCTACCCGTAAATATCCAGAGTTGACAAAGTTGT
TCCCCGTAACACACAGGAGCGAGCCGCCACTGATGCAGACGAACTTCGGCTCAACATCGAGTACAATTGGGGTCAAGATCGAGTAGCAGTTCGACGGCGC
TACGGACCAAAAGTCCTGACCATTGAGGGCCAACTCGACCGCTAGCTCTGTGGGAACGAGAGATACGGGCGCCCCACGCTGACGGAACGCACGAAGGAGC
TTCTCCTTCTTCGCATTGAGCGCGCTCTCACCTCGGTTCTTCCCTGCCGAGTGCCTTCCAGACTGCGGGTGAGTTGAGATGACAGAGATGAGGGACGAGC
GCAACGCCTTCTTGTTCTTCTTCATCTGCGCCACAGGAGGCACGAACGCGATCGCGAGCTCCACTTCGCCCAACGTTGGCGCTGTGACTGGAGCTGGAGC
TGGTTTCTTGGACTTTGACTGAGACTGATCCACAACCACCTCTTCGTTCTCTTTCCGCGCGTACTTCCCTCGAATGCGCCGCAGTGGAAACCACGCGCGT
AGAGCGAAGGGCTGCGCTAGTTGCTCCTTAACCGGGAACGTGAGCTCGACGTGTCCGAGACTTTCGCTCTGGTCCGCAGTTAGTTGACTTTCAAGCACCA
CGCGTACAGACGGAAGACTCGCTGGGTCACCTCCCACCGCCCACTCAAAGTCGAATAACTCATTCCACACGGGGGAGAAAGCGCCGTCCTTGCGCGTGCT
CTTGAGTTGGGTCTTGCCTACGTACACGACCGCGAACGGGTTGCACGCGTTCTTCTTGGACGCGCGCAGACCCCGCGCCCCCAGTAACGCCACAAACACA
CCTGCAGTACGAGTCCACAGCTTGGGCGGGCCATTCAAACGTCTAGGACTGAACCCGCCAGCGTTGCCTCCGCCTCGAAGCCTCGGAGTTGGAGCGAAAC
CCGGTAGTACAGACAACGGGAGCTCGGTGGGGACCGCGTTGGTCACGTTGAAGCGCGGTACTAAGCACTCGAACCGCGACTCCGACACCAGTTG