Description :
From Genome Similarity Track
Location :
Scaffold_10:134357- 136180
Transcript NameFunction/comments
Physo_525780leucine-rich repeat protein

Sequence
1823 bases(100 bases per row)
GACACCAACGCCAAGCTTTCATTTCTACAGGCATTTGGCGCCCTCGGGGTCCCGATGCTGCTCATTCTCGTGCTTTGTCTCGCATCAACTGCGTGGCTGA
TTTTCGTGTCGTTGGCTCCGAATGAAGCGGCCAATTGGCTCATGAACACAGGCGACTACGACAACGGGCAGTTCTGGCTCATTATCGACGCGAACTCAGC
GTTGACTATGGCAGGCGTCGTTGGCTTGGTGATCGTGAGTCTGAGCTACTTATTTGTGGTGCTGAAGATGTTGCTGTGGCGCGAGAAGATCCTCACTCCT
GCTATGCTTCGGCGACTGGAGAGGAGACTGCTGGGCAGTTGGAATGGGGATGGATCTCGCTTGGAGTCCAGGACGTGGTCGATCATTGTAGGGCCTACGT
ACCGACGAGCACATAGCGTCTGGAGGGACCTCACGTCGTTCAATGGCAGGAATCGGAAATTATGGGTGGGTACTGCGTTGATTTGTAAGGGTTTTCTGAA
GAATCTTACTTAATTTTTTTGTTTTTTGTAGAACGCTGGGACCAAAGTGGTCGATCTAGTAATGCAGATGCTCGTGCTGCTTCAGTTACTTCGGAGTGGG
AGTCCTGTAGCGCTCGTGTATGGCTACGCGTTGTTCGTGGCGGCCAATTCTCTGTCCAGTGCGATAAATATCCTGTTCGACCGTTTTTCAGCCCTCACGG
AAGTCCTCATTGACTCACTGTACGTACGATATCCAGCCGCTGAAATATGCCCCAGCATTAACTGACCAGTTTCCGTACAGCTTCGACTTCTCTGCAGCCG
TCTTGTTTCGCATTACCACGCTCGTGTATTGCTATTACAACTTCGAGTTCGATCGGACTGAATATCTCACATACTTGAAGATGCTCAAGCCTGGCAGCTT
CGAGCATATTGCGCGCTTATTTGGGGATCAATCCGAGATCGCGCTCTTCCGCGTAAGCTTCGACTCGCTTCGATTTAGCTCCGTGCTGGACTTGGTTACC
CAAATCTCGATGAATCTGGCATTCTGCTACCGAATTAAGCGCATGATGGAGGTGATGATTTGGAGACAGCACCACGCGTGGATATCGGGGCGGACGTTGA
GGAAAAGCTCAGGAAGTATCGCCCCTGTTGAGAATACGCTACCAGTTCCAAAAGTAATAGCTGCTGCGTTCTTTCTGTACAGCGTGGCAACTGTGGTGAT
AACCCACCAATCGGTGTCACAGTCCATAGCTGCGTGCTCGGCATATCCAGACTGCGTAGTGTACGCCTACCGGTGGACATCCAGCGATGGACCCTGTCCG
TGCCTCATCTTCATCGACGTCAATAAATCTCCAAAAACTTTTGACGAGTGGATTCATCCTCCACAAGCGTATACAGCGCTTGAAGCAGTATCGAAGTTTG
GAACACTGGAGTCGATTCAAATAATTAACCGTCAACTGCTCGAGTTTCCAGAAGAACTTCGCTCTTGCAGCAAGCTCAAATCGATGTAAGTACTGGAAAA
ATGAGAAGCACCTACCTATTTATTCACAAGACTAACATAATTCTTTATTGTGACAGTCAGCTAATGTATACCAGTGTGGAGATCATGCCTGCATGGGCAG
CAGAGTTCAGCCACCTCGAGACCTTGTACGTCTCTGATTGTCTCGTAAGCAGCATAGCTGTTCGTCCTAATCTGTCTTGCTTCACCTTTGCAATGTACAG
TCATATTGAAGGGAAACTCGGCAGCATAAATCTGCAAGAGCTCCCGGAGAAGCTCTTCACCAACATGCCAAACCTGGCAATGGTTCATCTGGGCGTTCAC
GGGCTTCGAACCCTACCACCATT