Description :
From Genome Similarity Track
Location :
Scaffold_450:13430- 31911
Transcript NameFunction/comments
Phyta_totarag8411hypothetical protein

Sequence
18481 bases(100 bases per row)
CCGGTTTGCCGACATCTTCGGTTGGCCGGTTGCATCTAGCGCCACCGTCGTCCTCGCAGTCGTATGGACGCTGTCGCCCTCTCCGTCTGGTAGACGCTTC
TCCGCCTGCAATAGCTCCAggtgtttcttcttcaagacgGACTCGAGAgcgcgcttcttgggcgACAACTTCCGGTTCTGCCAGAACATGTAGGTGCCAG
TCGGCTGAGCTGGGCCATCCtctgcggcttcttcgtcgtcgggcGGCAATTCGTCTGTCGCCTCATTGATCGTCGCGGGCCTCGCACTCTTGCCACGCTG
CATCAGCGCCGGCAGTTTGCCACTCACCTTGCGCATCAGCTTGTGCGCGAGTGACTCGCGACGATCTCGCAGCTCGCGTAGCAGGTTCTGCcgcttcacc
agcagctcagctcGCGGATCTGCCCGAGGACCGAATCGGTCGGACGAGCTCACGAGCTTTTCGTCGTCGATCCTTTTACCTGTTGGCTGCTCTGCAACTT
GTGTGGCTggtgtctgcagctcttgGTGGTACAGACGGACGCAGTGCATGCCGTACAGGAAATGCTCAAAGTCCACGAGGTCTGCGTACGCCGGATCAAA
cgcttcaagcagctcgcgaACTTTGGTCGCCGGAACGTGCACACCCAGCTCATATACAGCCTGTGCAATGGCTGTGTGGGAGACCAAGCTTAGctgagct
gcatctgcagaTGCGAACAACAATCTGAAAGCGTCgacctcttcctcgctgaAGTTTGTTAGCGTCTTGCGCAATGTCTCGCGCCGCTGAGCCGCCAGTA
AACGGTGTTGCTCCTGCTTGTGAGCTCGCAGGTGGCGCAAGTAGCGTGCACGCGTAGCTCGCGTAAGCAAGCGACGCTGGATGCGGACGGCGGCAGCGTA
ACGGAGATGATCGTACAGCGTGAGCGACTTGCCCAATTGCTCACGCTCCAGCGCTTTGGCGTCTTGTGGTCCAATGCGCAGCATAGCGCGCCCTCGGCGG
ATGATCCTGGCAAGTAGCGTACGAGACCACCAATCACGCAGCGTACGAGCCACGAtcgagatgaagatgacgataggctccaccaccaactccTGTATCA
CCACACCCACTGCCCAGGCCAGAACACAGCGCCAAGATGTGGCCAAACCAAGCTCCATCGCGCTAATTGCCACCACGTACGCCATGATCGCCAACCACAC
GAGACAGATCGCGAAAACGACGTACACAACGGACGCCGGGTATGGAACGCTTGTACTGTCATCCATATCAGCATTGGCAATCGTCTCAATCTTCTCCGCA
TCGTGGTGCTCTTGGTCTGATGGAGCGCTGGAGATTAGTACATGTTCATGCTTCAGCGGCGCGACCGCTAGCTCACTAGCCACTGAAGGTGCGACGCTGT
CCAAACTCGAAGCCAGTAGTTGCGAGCGCAGCTTCCCgcgagatggcgctgcaaTTTTGAGTCCAACAACGGTCTCAAACGTCTCGCGCACGTCTCTCGT
TacgtcgtcctcgttcgCGGCAGAGTCCGGCACTCGTAACTTGAGCTTGGCATCCTTGGAAATGGCTAACTCACGAGCGAGGAAAAGTGCAGTGACTGCC
ATCAGAAAGAGCAGTCCTGCCGCTGTCAGTGCACAGTACGTCGCCACGTCCGCGCCAGAGTGGAACCGAGCTAGCATCCCAGCACGACATCCCGGCAAAG
TGGTAAATTCCTGCTTCGTTTCGCTTACGACTGCGCCACTGACACTCAAAGCTTCGTACGTGACTTCCACCGGATCACCGTCAGGACACGGCAAAAACGG
CGCGTCTGTAGAGCTCCAAAACCCGCAGCACAGCAGTTCTCGCTGAACAGCATCCTTCGCGTAACCTGTGAGCTCTTCTCTCCATGCAGTTTCAAGACGC
TCGACAACATTGAAGCCTGTGGTGCGTACGCTCCAGCTATTCAACGCACTGGCGTCGTCTTGCACCACCTCGTGAATCATGAACACAGTCAGCAGTACAG
CTCCGAGCGCTAGTACAGCAGTGATTGCCACTACCACCAAAGCCACGATCACTGGAGTCGCCTTTCGGCGATGCGATCGCTTCATTTGTTGCTCCCGGAG
GTCGTTTGCCAATGCTGCGATCAATGCGACGACGATAAGCGCAACCgcgacagcaagcagctcaagaacgtcTTCGTCAAGTGGAACCCCATAGAGAGAG
TTGTTGTAGCCTAAGCGGAGCAGCCCGAGTAGCGTCGCGAGTGCACAACCTCCAAGAAACAGGACCACGCCACATGTCTGGAACGTCAAAGCCACGAAAC
GTGTAAGCCATACGAACCAGCGCTCCtcggtcgtcgtctgcgtcgcCTCAAGCGTAAATGTATCACTGGTGAGAGCCGATCGCTCCACAACCTTGGAAGA
CTCCGGGATGTCTGGTCGGTGTCGTCGAAACCACGGCGCACGGAACAGCAGAACCTTCTCCTTTCGCTGCCGAGCTGAGGCAACCTCCTTGGTCTCATCA
TCTGCGCGGTGTCGAACATGCTCAAATAGTGCGACGGTGCTAGTCTGCACTACGAGACCGACAGCACCGCCATACACTAGTCCGAGACCGAGTAATTCTG
CCGCACCTGGCTGCTCGCACGACTTGAGCGATGTCCGATAACAACCTTTTGTGGCGAAGTAGCCCGCATACACTGCGAGCGATGCAGCCCAAGCACAAAG
TACACTCACAGCACGCTGTGCTCGGGTGAGTCGAGCATCAAACCTTGCGCCGACCGAAACCAGAACGTGATATCGCCGGAAGTCGCGTCGGAAGCTACCA
GCCACGTAACGTAGTCTGCTCTCGAGAGCAAACCAAGCCTCTCCTTCGTAGTTTCGGACATCACGTAGTACGAGAATACTGAGCACAAGAACCACAATTT
CCAAGAGTGCAAGCGCTAGAAGGAACGCAAACAGCCAAGCAAACGACGACTCAACTTCCGTCACAAGCGAACCCTTGCAACCACGCGAAATCGCCAGTGA
GCAGCCTGGATATCCGAGCGCTGGGCGGTCGAACACGACGCCTTTGCCTGCCACAAGCACGGGGTCGTTGAAACCACAGCATGAAAAATCGAGCGCTATC
GTGTTCTGTGTCGATGGCGTCAGGAGGCTCCATTGATCATCCAGGAAGTCTACGAGTTGTTCGTGCCAGCTCTCTTCGGACGCCGACGAGTAGTGTGAAA
GGTGAGCTGTGAGACCTACCGCCGCAAACAGCGTGGTGGCAAGTACCAATCGTGCTGCACACTGCAGGAATAGTTGATGCACACAaagctgcagagctgc
acGGGTCGAGTACGCGTGAGCGAGTAGAGCGAGCACTCCATACACCATCAACAACGCGCCCATCGACCGAGCAAAGACCATCTGGAACGCACTCGAGCTG
AAGAGCGTCCAACCTAAAGCCACATCCAAACCCAGGACGAAGCACGCTAACGCAGCGAAACCTGCGGCCAAAGCCGCCAGAATCAAGGCGAGCCGCTCAA
TGTGCAGTCGCCAACCAGGATGCCACTTCCTCTCACGTTGATCATTGTCGTATAAACCGCTGGCACagagcagcgctgcaacgcTAAAGCCAGCCAGTCC
ACTGCATAATTGCCAGGCGATGCGGGCCACACGAGAGACATAGTGCTTCATGGGGGTAGCGCAGCCATCAGAAGCCTCCGACGGACATTGTGTGCTGTTG
GCCAAAAGTGTCGACTCTGCCTTGGTCTCTGTAAGCGCACGCGTCTTCCGTGACTCCAGGCCAGCTCGCGAGTTGTACACGTGATAAGTGGACGTTGAGG
CGAGTCTCCGCCACCCAAATTGTTCAGCTTGAAGCGTGTACGACACTGAGCCATTGTCAGCTTCAAAGCGTTCGTAACCACAGCACTGGAGAGTGTTCTG
CACAAACAACTTCGTAGTAGACGGAGCTGAGCTCCACAGATCCTTCATCCGCGTATCAATTGCTACTGCTTTGGCTatggcgtcgtcgccatcagTCGTA
AGGGTAAACTGCGATGAAAGCTTGTGCCCAAGACCAGCCAAGACGAATGCTGCTATGAAGAGCACAACGCACGCCAACGAGTAGCAAACCACTAGCCACT
TCCGAGTAGTCTTCACCCTTGATCTTTGTTGGATATCTTGAGTGCCAAACCACGCGACGACGCAGCCGAGTGAAGCAAATATCTCCATCGCGCCTCCGAA
GATAAGCAAATACACGCCTAGACGGCGGTCGAATACGCGCAACAAGTACGACATTTGCAGCACATTGAGTTCGAAGAGTACGTCAACTCCTAGACACAAG
ACGCCAATGccagccgctgcagctcccaAATTCAATAACATTAGCCCGCTTGCACAAAGCTTTTGAGCTAGTGTCGGTGGATCGCGAGCTCTGGATGCTT
CGTGGTCGTCTGGTGAAGACCGAATTGCCATCAGACCAGAGAAGCGTCGTAGTCTCATGCACAACCAAGCCAACAGGACGAGTATGACAGACTGAGCCAC
TGCAAACCCTGTGAGACGCTGCGTTGCTAGCGATAAAGCACTCTCCAGtgccttctccacctgcaccCGGCAAGTAGGAACGCTACCGTCTGACACATCT
TGAATGCACGTCCCTTGTGTGTTGTCTCGAAAGCCGCAGCATCCCAAAGCCATTTCCACATCCAACAGCGTTGTTGAGCGCGGCAGCGCCACAAACTTCG
CCTCGATCGCTTTGCTGATCGACGGGTCCAGGTGAAAGtcggcaagaagacgttcTGAATACGTGCGTACTGCTAGCGTGAGTAGCAAGAAGGCCAGTGA
TAATCCGACAAGCCAACGGAGAGCTCGTACATCACGTCTACCCAGCGCACGCAACGCCCACAACGTAAGAAGCAGAAACACAAGTGCCCCAGCAAGTATC
AAAGCACCGATATCGACACCAAACAGCGCAGACACGAGTGGATCGGCCATCGCACCCCAATGTACCATCAAATCTACCCCAAAGAAGACGccacccgcag
cagcacaggcaaCAAATGCGTACAACGGCGACAGAGCGCACAAAAGTGCGGCTGATACCAGTGACCGAACGATAGCTGCCTCTGCACTAGCAGAGAACCC
ACTGGTAGCAAGTTGCACCAGTCGAATCCGTCGCCACCGAACGAGAAAGTTTGCCAGCGCAACGCACGCGATCTCCACGAACAGCACAGTCTCCACATAG
ACAAATGAGCTGGAAAACAACGCAGACGCCTGTGCTCCAAGCACCACCGCGCATGTCCGAGGAGGTACCGCATCTAGAGCTTCCTCGGGACAAGAAACTT
CCTCACTGATGGCCAGGAACCCACAGCATCCGTAGGACGTCTGAAGTTGTGTCTTCTCATCGGAAGATAAAGCGTCCCAGCCAGAGCATAGTGCAAGTGC
CACGCCGTGCGGCATGGCGTCCAAGTTCTCGAGCAAGTGAAACGTGAACATGACAACGAGCAATTGGGCCAGCAATGCGAAGCCTAACGATGTCAAGTAG
GATGTCCGGGCTGCGTTTGACGCGTCTcgtcgagcaagaagaacaccCGTGATTCCCCCTGCAACCAACACTGCACCGCCCACCATGAGCGTGACTCCAA
GCGGACCTCCGTACAAGTACAGCACGAACTCTGCTGGAGTTCGTCCGAGCACGAACTGCACTTCAATTCCggcaaacagcagcacaagtccCAATAGCGC
CAAAACCAAGTTGCTCACTCGGAAGAGCAGAGTCACTCGTCGGTACTGTCGATCCACGAGGTTAGACGACCCGAACAAGGTGCGTGCTTCGTCGGGTAGC
TGCACCGAGGTGTCTAGTGTCTCACTGGAAGGTTCTGTCATTGACATATCGCTCACGCGCAACCCACgcacggacgacgagaacagCACAGCTGAAGACT
CTCCGACGTCCGTCGCAGTTGTTGGTGCCTCGGACGGGCGCGTTTCCAaccttttcttcttctgggcGACGTAGTACGCGTCAAAGCCCTCGAACACGTT
GTTGATCTGCGTCCGCGCTTCCAGTTCGTTCCATTTGGCGCGGTTGAGTCTCTTGATAGTCGTGAGCTTCTCGCGTTGTACATCTCGCGCATCTAGACGC
TGACCGGCTTTTGCTACGACAACGAAGACCCCAACGAGAACAGCGAGAGTGACGCTGACCACGAGAGAAGGCTGGTCGTTCCGGTACAAATCCGGGTGCA
GCGCGTAGAAGTCCAATCGCTCTTCCAGAGTTACCAGCACTTCGAGAACCGACTCGACCTGCGTGCAGTAGCAGACCGTGAGCTCActcgtgctggagct
gtcgtccTTGAAACACACGTCCACGGACCAACTTGAACCCTCAGCGTCCCATGTCCGACACGCTGTAGAGAAGTTGCTCTGCTCCAAGGCTGACAGTTCA
CGCTTGTGCGGAATTGTGAGCGCAACCAGCGGCACCCACTCCTCCGTTTCTGCATCATCAGACGCTAGACGTCGCGTGGACTCGGAAGATTTCCTGACGC
ATGCGCTCGTACTCGCTAGAGTTTGCATGTCGACACCAGCTTCGGAAGAGTACGTCGTCACGGTGGCAGCCCGATCGACTGCGGCTTGCGAGTGCACGGA
AAACAGAGTCAGCCGAGAAATCGGCTCGGAGTCGTTGAGAGTGCACGCAGAGTGCGGACTCTTGACGAGTGCAATGGCATCCAAGTAGAGATCCGAGTCG
AGACACGCTACCGCAGTGGACGTGAGAGTCATCGACACTTCAATCGTTGAAGTAGTGAAGCTCACACCTTTTGAAGAGTAAGTGCGTACGTCAACAGCCT
CCAGCACAGCAGGCGGCTCGTCGGCGAGCAACTCGTCACTGCTAAGCGCCGCTAAGGACAGAAGCGTACGCACTATATTGTCCCAGTTCGCCTTCTCGCC
AACAGCAGTGGTTGTGTTGGTGCATGTAGTATTGTCCGAGTCCGCTTCTGCAAGTCGGCGTGCGCCCGCACTACTGGTGGTGCtcctgctggagcttcca
AGCCCGAGGAGAACCGATATCACTTCCAACAAAGTCTCACTTGTTGAATCTAAGAATTCGTCCGAGACTTCTAGAGTGAGTGCGCTGCCCGCAatgccgc
tgctgagctgAGTTACGAGGCTGATCGCTTCCAAGTCCAACACCTGAGGCGTGCCCCGCACAACGGAGCCAAGCACCCGAGCTTGTTGCGCAAGTCCCGA
ACTACTGGCCTCCTCTGTACTAACTGCGCTCGACACTGTCGCCAAGATGGCAGCATTTAGTTTCTGCACGACAGCAACCTCCGTGGCGCAATTCTCCCCC
ATGAATCCTTCTGGACAAGTGGCAAGGCGGCGAGTTCCTGTTGTAGACCCATCCGAGCCGAAAGCTTTCTCCAATACCATGGCAGCAGTCAGAACTTGCC
GCACACTCGCGGACCCGTCACCACGGGACTTGAGCGCACCACTAGCATCAAACATACGTGAAACGAAGGCTACAGGTGACGACTTGGCTGCTTCAGGTAG
CAGCACCTCGACTGTATCGTACGCAAGTGCCACTGCGCCCAACCGATCGCTGATAAACGCGAGGACTGTCACGCTCGCGCTGTCCGCCAAGTCGGCAGGA
GGGAacattgtcgtcgtcgctgacggTGAGCGTTGACTCACTACCAAAGGCGTCATGGATTTCCGCAGCTGTGCCACCAAAGTATTGGAGTCGGTCGCGT
TGTCCTTCAGCAGATCGAAATTCGCGGCGGAAAGCACTCCGAAAGCGTACATTAGAGGGTAGTCGTCCACATCATCGCTCCACAGTGAGCAAGTAAGAGT
AAACTCGTCCTGCATGGCGTAGCCCGACCGAGGACTTACGGCAAAAGTACCAGAAGTAGGCGGCGAGTTCACGAGTACGGAGACGGAGCCAAAGCCTGCG
TTCCCTTCCGTATCGGTGGCCACAAGGCGGAAATTGTACGTGAGTCCCGACGTCAATTTGAAACCTCGAATTGCGTTATTTGCGCTCGTTAGCGGCAGCG
TGAACGCGTCactcgtgttgctgctgtctgccCCAGGAAGCACCAGGTCCCCCAAGGTTTGTGTCCACCGCGTGGTGTAAGGATAATCCGAGCTCACCTT
GCCGGTAAGTGCCAAGCGACTGGAAGGATTAATTTTCTCGGCGGATGTGGTGACCAGTACGACCGGAAGATGACCCACTGCGGTCCAAATCGTGCTTGAG
GCCGTCGCGCTACGGGTCCCTTTTGAAGCGGTTAACGAGAACTTTAGCTGGCGATCTGACACGAGGTTGAATGGTGCGATTTTCAGCACAGGTCCCGTTG
CAGAGGTCAATACCAAACGAACGAAAGGTGTGGTCGACGCGTTCATGCACGAAGCCACAGATACGCTGGATGAATTCGTCACATCCTGACATTTCCACGC
GTACGTGAACGGCGTGCTTGAAAACTCTGGATCGGCAGTTGCGGAGCCGTCGAGGACAAGAGCGTCGCGTTCGCCAAGCGCACAATCGCCGCCTTTAATG
GAGACCAGCGGCGAGCTACTGGAGACGATCACCGAAATTGATgcgaagctgctcgacgactggTTGGAAGAAGCTCCCTTCATGTAGGCTTCAGCTCGGA
AAGAATACGTTAGACCAGCCTGTAGTGACGAACGCGGCAAACGGAAAACACGCGGGTCTCGGGCGGAATTGTCCTTGCTGAAGTCTTCAGTTGTCACTGC
CCcagtgctgtcgctgcttttgctggtCGTTGTCCAGCGGTAGGCGACATCCGAACTCGATAAAGTCGGACAACTAACCACCGAgtccacctgcagcacg
acggGGGCGCCGACTTTCGTCACGGTTTGGGTAGAATCCCCCACGATAAACACGGCTGGTCCCGGTTGACTTTGCAAGTTAATAGGCTTGGAGACTACCG
TGGTTTGAGCAAAGACGTTCACTAGCTTCAAGCCGACGCGATACCCTGTGCCTGGTTCTAGTAGGGAGCTGTTCACTTGAAGCAGTAAAGCACCCGCTGT
CGTGGCATTCTGCGCAACCGATCGAAGGTGGCAAGCGGATCGAAGCTGCGCCATGGTGGAAAGGGTCGAGAAATcagacgcagcgctgctgttAGCAGCC
GCAGCTAGCGTAATGTCCGCAGCCGGAACCAGCGTAATACTTGACGTACCGGCGGTCCAGTCAGCTCTGTACTTTTGACAGAGCACAGCAAGCCCCGCAT
CAAGCTTCTGGTACAAGGCCAGACCCGCGTCGGCACTAGTTTGGTTGATTGAGCTGGAGAACAACGACGCGGGGAGAGCGAACCAGGCCAACTGCGTGAA
TGGCcggcctccagctccactcgAGAGTGATGCATCCGCCGACCACGTGCCACAGCTGCCAGCATTCTCGGGGACTACAAGCACCGCACTCGGTTGTACA
ATATCCACTGGAACCTGCACTGCAATGCTGGCTTGGGAGAACGCACGACTGGAAGGTCGAGCTCGAAGTACGTCCGTAGCATTGCAGTATTGGTCAGCAA
AAGAGCTGCAGTCGTTCAGCACCAGcctgtcagcagcagccaaggTCGCGCCAGCGCTAAGCTCGATGCGCAAGTCCTTCCCATCGACCCACAAACAAAA
GGCTTGAGAGCCTAGCGAGTACTTCGCAGCAGCCAAGTTGAACACGAGACTGCACGGAAAAGTCTTGAGCCGCGTCAAATACGCGCCGGAAGGACTCACA
CCCATGGAGGCCGCATGGTAGACGGCCGAGTCAAAGGCGATGTTGATATTCGAGCCCGAGCTGTCAAACATCGCAGCCACCGGTAGCGGTGGAGGAATAG
CTTCCCTGTCACTGATCATCACCGACACTGCTACGACTCCAATTGAACTGTTCGAGATGTTGTAGCTGGCATCGGCGCTTGCCACTGTGTGGAGAACCGT
CGAGTACTGTGTGGCAGCTTCGGGGATTTCATCGTCGATGGCAAATACCGTCACAACTTGTGGCCGCGACCAATCCAGAGGAGTGAAGACCAGTTGAATA
CTGCGAATGCTCTCAGTCCCCAGTAAGGTCAtagacgaagacgaagacgaaccGAACGACACCCCAACTTGTGGCTGTGTGAAGACACTCTTTGAGTCGA
CGATACTCGCAATTTTCTCGATGGCAGGACGCAACGTCATTGTCACGTACTCGTACGGCTCCGAGTTGAGGAAAACGCTGTAGGACGCGTTGAAGCTTCC
CTCAGCAACGTGGAGTTGGTTGGTCACACTTTGCCTGGAGATGTTCACGAAAGACACGTCGTTGTCGGTGATGAAGAGCTTGACATCGCCACCACTTGCT
GCGTAGTCACTGACAGCGTACAGAGGATCGGAACTCAAGGACGCGTGCGAAATCCGAGTCGAGTGAACGTTCGCCTCGTCCAGCCAGTCGTCCACTGCAA
TGAGAGACACGTTCTGCCACACACTCCAGTTAGTTGCTCCAAAGCACAGCGAAGTGGAGCCACTCAGAATACTGGCATTGCAGACGCGCTCAGCCGTTTG
AACGCGTAGATAGCAGTCGTAACTGGCGTTTGGCTGAACGACCACGGATGCCCACGGCTCCGACGTGAGACGAACGCTGTACCAGAGCACAGTAGCGTTG
CTCTCCGACGCGCGCAGCTCCCGTGTCGAGAATTCGATCCCCGACTTATCGTTGTCGGTGATGAACACGTTCACCGCTGCCAAATTACGCAGACCCGCGT
AGATCAGGTCGTTCGTTGTAAGCGAGTGGTTGAGCGTGCTTGAAGAGCCCACAACGTCTTGAGTTCGATCGTCGAATGCTGTCACACTAACCGTCTGCGT
TTCATTCCAGTTGCGCCACGTGAAAACCAGCTTCGTGGGGCTAGGAACGGCTAGATTGCCCACTGTGCCGACGTTGGTGATGGATACGGTCACCTTCGCG
AATGGCTCGGATGCCAGCACGACTGTGTACGAATCGTCAGACCAAAGACCCTCAGTcacgaagacgctggccTTGTTGACAATGAAGCCTGATGCGTCGT
TGTCGTGCACGGTCACGTCTATCTTAGGGATCGTAGGAATTGCGTTGTACTTGGGGTCGTCGCTGTACGATACGTGCATGACGCCAGTCATGTGCGTATC
GTACTCGTCCAGGTTGTCGTCGGTAGCGAGCActgccaccttctgctgcacgttcCAGTTTCGCGGCGTGAATACGAACTTGCTTACAGGAAGGGTGAGG
TTGCACAGTCCAAAGCGATAGCACTgagtgttgttgctgtcgagcCAAGGCAGAACCACGATTTTCACGTCGGCCAGTGGCTCCGAGCTCAACTGCAAGA
AGTACTGCGCTGCCAGTATGCCGTCTTCGCTCACCTCAAGTGCCGACTCGGACACGAGCACTTTGGCCAGGTCGTCACTTTCGACTTTGACGGTCACATT
GGGCAAAGGACGCGTCAAGTAAATGTAGTCGTCGCTGAACACGGTGTGCGTCACCTTGGAGAAGGTCACTGTGCCGTTCTCTTTGGTGTATTCGTCGAGG
TGGTCGTCCACAGCCTCCAGCTTGACTTGCTGCGGAACACACCAGTTCTCTGGAGTGAATACGATCCACGGGTTCAGCACGGTGTAGTTGCAGAGGAATC
GCTCCTGGGCCGTCTCGTTCGCGATAGCATACACGCAATAGCCCCGAAGTCCCAGCGAGTCGGTTGGGTCAGGCTGGAAAAGCGCAGTAGGGATCGCAGA
GCACCGTGGTTTGCCCTGAAGATCGAGCTCCGACGGGACTGGCAACGGTTCTATCTCCTGCGTCACGAGGGACGTATCCATCGTGATTTTCAGGTCGGCA
AAGCGCAAATAGTCCTCAAGAGCCCACTCCAGTCTCCACGTATGACCACCGTCAAGATATGGGCCCTCGCGATACACGCGCACACCCTTATCAAACTTAA
TCCCGCGCCATATCCTCGTCCCCGGGTCGTATTCTGCCTCACGGTTTGAACGTACGAAGTACAACGCCTCCAAGGCTTCATCCATACCAATTGCACTCAC
GTTGACAGGCAGCGGCCATGTCGTACCAACATACGAGCGATTGGTGTCTggatccagcagctcaagtcgcAACGTGAAGCTACCACCCAAGTAGGTGCca
ttggcggcggtggcggacGTGAGAGTCATGCCAGGTGCTTGACGCATCACAGCATCTGCAAAGACTGCGATCGGCGGCAGATTTCCAGGACTGTTGGTGT
AGCTGATGGTCCACGTGTATCCGTTGCAGACGTTGAAGCTATCACACTCGACACCCACTCGTGATACATCTGCTTGCTCAGTGATGTCCAACGCGAAAAG
CGCCTTGCGAAGCCGCCTAGCCGTCGAATTAAAGAGCAACGCCGTCGTATTCTTCAGTGGGAGATCCATCATGTAGGCGCGATTCGTACGCGGGTCGGTC
TTCTTGAACCGGCCTCCCATCTGCACGGAGAAGTTGCCTCTCAAAGACTCTCCGTCTCGCACAGTGTTCACCCCAATGGTGACGCCCTTGCCCGTCATGT
TTAGTGAGGTTACAATCATGCTCGGTAGGTCCCCGTAGTTTTCAAGGAACTGGACAGTCCACGCCATTCCTCCCTCTGCAGACAGTTTTTGACGCGACAC
TGTCACATTCGCTACGCCCTGAAGCTGCACTAACTTGGCAGCGAGTGTGTCAGCCGAATCGTTCCAAAAAATTGGCACTGTCCGGTTGGGTTTCGTAGAG
CTGGTGATGTTGAGTGGGGCGAAGTAGTCGATCACAAAGGCCCCGCTGATCAGCACAGGCGACTGCGTTTCAGTCACTGAAATCGCCACTTGGGTCAAAG
AGTCTGCGGAAGCCACCAAGCTGGTCGTAGAATTCACCACCAAACTCGCAAATGTGTCCACACTCACGAAAGTCAGGATGTACTCGAATCCGTACCCTCC
GCTACTCAGCAGCTTTCTAGAGACCGACACGGAATAAATTCCCGTCTGGGAACTCAGTGTACTTTGAAGGGCAGCAGCCGTCGGCAAGACCGGAACTTGA
AACGTAGCAGCACCGTAGCTCAGTTTGAACGACCCACTAGGAGAACTACTTGTTCGATTCCGTTGACATGTCAGTCCGCCTTGAATCGCTCCATTCGCCG
CTACAGTGAGGAGCGGAAAGGTTCCATCGGAACTCACAAACCGCAGGAACGTAATACTCCACGTCAGTGTCGATGCTGAATATTGAACGTCTCGTGTCAC
ACTGACGGCGTTCGTTCCACCAGGAAATAGCCCGTTGGTCGCTGTTTGGACTTGCTGAGCTGTAGAAAAAAGATCAAGAGCTGCTGTGCTGGTTCCTGCT
CTATTTGTGATGAAAAATGTGCTGCCATAGCTAGCAGCGGCTGCGATAGCATTAACAAACGGGAACTGCGTCTTAAACGCGTCGTTAAACTGGAAAACGA
TCGCCTGAACCTCCAAGCCGAAGCCCCCAGACACTGAAAGCTGGACAATCTGGTCCACGTGACTCGCGTAGGTCACGATTCGCTGCACTTCGGTGATCTT
GGTCATGCGTAAGGCGATTTGGTGGATCTCCCGcgtcgagttcgagcgcaGATGTACCAGACTCACACTCTGTTGGCGAGGAAGTCCACACGAGGGTTCG
TCAAAGGGGTACCCGCATCGTCGATAGCACGCCTTGTTGGCCTCGTTGCTCATCGCAATGGTTACGTTGGCGTACGGTTCCGTTAGCAATCGGAGTGCAT
AATGGTCTACGTGTGGGTACTTGAGTGTGGACTGAGAGAGGCTTTTCTCAGCAAGTGAAACCAGCTTTACAGAGTATTCCATGTccgtgtcgtcgttgtc
tgcaATTGCCACGACGATGTCTGGCAGCACCAGAGCGTCGTACACAGGGTCCAGACTTTCTGATGTCGCGCGAATAATAGCCAAATGcacgtcctcttcg
tcaagATGGTCATCCACAGCAAGAACTCTCACCGTCTTCGGCAAGCTCCAATCACTTGCTGAATAGACCAGAATGTCAGGGGAGACCGTGATGTTGCACA
GCAATTCACTTGTACTCATACTCTCCGTATCGTCTCCACAATTCAAGAACGACGTGTCCCCTGCAAGCGCAAAATTCCCATCGGCGAGCTCAACCGAGTG
AGATGGACACAGAGGAGTCGCCACACAACGGCGATAGCACTCAGAAGCGATGTGGAGAGTCACGCGGACTTCCTCCGTTGGCTCCGACAGCAGAACCACT
TGGTAGTCGTTGCCTTTGCCGTCTTCTGACACACTCAGCGACGCCGTCGAGAACTCGATCCCCGGCACAGTCAAATCCGTGATCGTCACCACTACAGGAG
GAACGGTGATGGTCTCAGCATACGCATTGGCAGCCACAACGACTTCTTCTACAGGTTGTTTGGCCCATTCCGCGTGCAGATCTACCAGCGCACCTAGTCG
TCTCGATTTTTCGCTAGTGCTCTCGAGTATCCTGTAGACTACGAAGTCACGGTAGAACGCCGTCACAGATTCCTCCAAgtcctgcagaagctgctgccca
CCAGAATCTCTGTtcacgctggacgtgttGGCCTCCGATGTGAGCTGGAATAACGGCGGACTAGAAGCAGCGTGGAAAATATCTGAAGTGTGCAAGCCCT
CGTAGAGTTGATCGTCCGTACCAAGAACATGCACAAGCTGGGGCAAGTTCCAGTTCTCCGTCGTGAATACCAGCACCGACGGTATAGTAGACATGTTGCA
CAGGTTAAAGCGATAGCAGGCGCTCTCCGCATTGATCTTTACAGTGACAGGCTGCAATGGCTGGGCTAGCAACTCGATAAAATACGTGTTGTGGGCTGCA
GTCGCCTCGGTAGAAACGCCATCGAGAAAATCGTGATAATGGTCCAAAATCTCCGTGGTTGTCAACGCGCGAACAAACCAAGACACACTAGCGATCAGGC
CCACGAATCCACCACCGTCTGCGACCGAGTTACTGTCTGTACTCACAGGTGATGGAGATCCGAAACGAAGAACTTTCTCCGACAGACTTAGCAGAGCCGT
GTTGCACGTCACGGAAGTCGTATAGCAGTTGGCCATCTGCAGTTCGCCCGAGACACAAATGGAGAGAGAAatgctggatgaagcaggGGCGTAAGTCGCT
ACAGCTTGGTGCCAAACCTCTGCAAATGGCAGCACGCCGGCATCTTCACCGAGCTCCGTCCAACACACCGTCCCGTCATCTGGATTGGTCACCTCGAAGT
AGAACCGCGCAGTTTTGCTACTGATCCCGACACTTGCGAAGGTCACCTGATCACCACTTGAGTCTTTGCCGTACATGTTGACGACGTTGGTAGGGAGATT
GTCCGCCATAGCAGCCACAAATTCCTTGTTGATATGAAACCAGAACTCCACTGAGAACGAGCTCATGGCCGGCTGAAGCGCGACTGCAGAAGAGAAGAAA
GTTCCTTCAAGGTCATCGTCGATCTTCAAATCCGCTGAAACCGAAGTAGGCTTGAGCTCGATCGCGCCTGTAGTTCGACTGTACCCACCCCACGACGTCG
CACCCTCATCATTGCTAACGATCACTGTAGAGGCTTCATCGAACGGCCAGATTGTCACCGGGTTGTCGCGCAGTAGTAAGACGCGATGCTCGTTCACGGA
CAACGGAAGCCGACCAACTGGCAGAAGCTCAGCTTTCCCTAGAACTGCAATATCAACGAAGTCACTGAGCACCAAACTACTTCCAGCTGCATTCGTGGTG
CGAAGAGGTGCTTGGCAGGCCTTGTCTGCACACACGTAAGACTTGCACTGCGAAGATGGAGCAAGAACAACCCCCGCTGCACTCAACGCGCATACGGTTG
ATGAACCCTCGGAGGCTAGAGCTCGAGATGCAGTCTCACTACGGCTACCGTCTAGCACGGAGCCATGAGAGGCGACGGAAAATTCAGCCACAGGCTCCAC
ATTTGAAGAAGAGCACTGGCCGACATTCAAATCGATGTCGACAAGTCCAACCTCCACAGGGGCTTCGAACTCTAGCACCACCCACTCGTGATAGGACGGA
CCACTAGCCACATAGCACACGGTGCTGTCCGTAGCCTTTAATAGTGCATTTGCTGAACCTGCACCTGTGCTCGCAAGTTGCGAGCTCACGCTGTGAATCT
TGTAAGATATTGGAACCGGCATGGCGAGCGTTTTCGAGTCTGTGGGAGCTACATCACTTGGCGGGAATACCTGCACGCTAGCAACTGCCAGAGGCTTCTC
TACTGTGCCAAACAGGTCTAGCAGCAGATACCGCGACAGTGTGGCTGGGTTCCAACGAACAACTTCTACCTCGTTCAGCATCAACACACCGTGGCCACGC
TTTCGCACAGTCACAAACCGAGCTGTCGAGAACACATTTTCCCACGCAATTGAGTTCGTGTAGTTGGCACACGAGAACGACAGCGTTGTGCTCGCAGTAG
TGGGGGACCCAGACAAAGTGCCATCACTTTTCGTCAATGGTTCGTTGGACAGAAGCACGTCGAATTGCTGGACAAACGGagccttcagctgcagcaacag
atcaACGTGGCTGTAGTCGTAGAGATCACCTGTCCACGCTGGGTATCCATTGCTCCCGGTTGACGCCGCACAGAGCTCATCGAAATGACTTCCAACGTAA
GGATACAGCACGACAGAGTGAACAGGTTTCACGCTCCCCAGATCAACTTCCCACCATGGAGCAGTCTCCGCATCCGTTCGAGTACTGCCTGCCGCCATCG
TACTGTCACCCTCGTCCTGGATAATGAGAGGATCCCATCCGGTGTGTCGTAATCCGTCCACGGCCAAGTAAGAAAGCGCATCGCTCGGGTTTGTGCTGCT
CTGTCTGGTAGCCATACCAACCGCCAGGTTTTCGTTCTCAGACCTTCTTACTGTCTGCAGGAGGTGCCACGATTGTAGCAGAGCTGGGCTCGGCCCCCAA
TCGGACTTCAGTCGAGAACGGATCCCAGCTCCATCCGCTGTCGGCGTCACCGAAATGAACGAGTCAAACGCCTGCACCTGCGATAGTTGCAAGGCTCCAG
TACCCTCGCGATAGATTCGCACTGCAACCGCACCAGCTTGAACCTCCCAGAGCAGAACCCCCTTCCGAACGGTGAAGCGCTCGAATTGGGGACAAGCACT
TGGACAGCCATacgcagatgcagcatcGAGAGACAGAGGTTTCGCATTGAATGCCTTCAGTGAGGCAACCACCACGATGTTGACAGTATCGGCGCCCGAG
TTCTCTTTGACACTTGAGGCAGGTAGGAAAACCGCCAACGTCCCCAGCTTTGTTAGTTGAGGGAGCGTCACCTCCCACCACGGTTCACTTTCGCTTGCAG
TCGTTGCAACTGCAACGGTACTGCCGACCGAATCATCGTATTTAGCCCCATTGGTGGCAAGCGAAGCTGCTAGAGGTTCCTTGGTCAGCAGAGATGTTGC
AGTTGAGCTTTGTGTAGCTGCTAGACCGCTGAGGATATTTGGGAACTGGTAAGAGAGAGATAACAGCGGACGCAACTTCCTCTCAAACACCGACGAGCAC
AGCTGAGTCGTAGCGATCGACTCAGTTCTGCCCCCTTCCGAGAGCACCTCGATCTGCAACGAGAGCACGGATAGTCGCGTAGGAAGCACTTGCTTCAGTA
ACGGGGAAATGTCCACCTCAATGGAACGGCTCTTCTCCACTGTTGCTGTGACCTCCATAGACGCACCAttcgacaagaacgacaGAGGCTGGGGCGTTGC
CTGTCCGTCGCGAAGGCTTTCTGCCGTCCAGGAGTTGTCAACCCCCGTCACTTTTAGCACATAGGCCTTCGTAAAGCTCGCTTCGTCTGAAGAGGAGTCA
CTTCCTGTCGACGAATTGCTACCGCTGTCTAGCTCTGATACACTGAAAATCTTGTACGGCGTTTGGTGGAGCACTAGTGTCGCCCCCGAGTAGGCAAGTG
ACGTGTCTGCATCGTGCACGCGCGGGAGATGGAACTTCATGAACGTCTTCATGCCGGACGCGAACACCAGAATATTCCGTAGAGCTGAGTCTATTGTTTC
TGTTGACACTGATACGTCGTGGAATGCTAGGGCTGTCACGTAGTCTCCCACCCAGTCTATTGAGTCACTCGCCTCTTTCGTTGCAAGCTTCGCTTGGGGC
TGGTTGACCACTACATCAACCTTTGCAACGTCATTATCTCGCACGAAAACATTCACACGCCTGTGATCAGGTGAGTAAAGAACCGTTGGAAGTGGGTTGT
AAGGAATGGTGCCTCCACCCACAGAATTCCAGAGAGGGTAAAGCTCGTCACCTGCCGGTGCGATGGTGCCCTGGAACCAAAACGCGGTCGTGTTCGTGTA
CCCGTAAGGCGAATTCTGCACCCGATGCGAAATCGTAAAACTTACGttgagctccgccaccgCATCGTCTACTGCACGCACCACCACACGTTGTGGCACA
AACCAATTGGTGGCAGTGAATGTCAAGAGCGAGGGAGAAATTGCCACTTGTGAGTTTCCCACGATCACGATGCTCACGTTG