Description :
From Genome Similarity Track
Location :
Scaffold_1057:1343- 3207
Sequence
1864 bases(100 bases per row)
GTCGATTGTGGTGCGGTTTGGGTTGGTATGTGGGCGCTTAGCTCAAATGGTAGAGCGCCCGCTTCGCATGCGGGAGGTAGGGGGATCGATACCCCCAGTG
TCCACTTTGCACTTTTTACAAATATACCACGTTTTACAAATATACCACGTTTTACAAATATACCACGTTTTACAAATATACCACGTTTTACAAATATACC
ACGTTTTACAAATATACCACATTACCACTTTGCGGCTCGCTGTCTGTCTTCTAGCGCTTGCTTACAGTTGCTTGCAGTTCTGGGGGACCTGCGTCGTCGT
CAGCTGGCTTCCGTTCGCTCGCGTAACTGTTTAACGCTGCTTAACTGTTCAGTTACCCGGCCGAGGATCCAGGCATCAGTCACTCAGCCAGTAAGGGTCA
GCTTCGATCGGTCCGTCCATTGATGCCACGGCACGTGCTGTATGGTCCTACATTGCAAGCAGCAACCCGGCTCTCGTCAAAGCGGGGGGAGGCGGCGACG
ATGACTTCTGTTGCGAGAGGTTAGCTCGGACCACCCGATGCGGAGCTGATCGAGCGGGGTTCGAGTCCACCCGCAGGACCATTGTGCCAATGGGCCAATG
TCCGGCTCAGCAATCCATGTCACGAGTCGCGTCCCGTGTGCGTGTGGGAAAGCTGCAGAAGCGGAGGAGCGATGCGGCGGATCGGTGCAGTGGGAAGAGC
GACGACAGCCGCGGCTGAGAAAGAGGAGATTGCATGTTGCATGCGTGGCTGGAGGCGTCCGTGCTTACGTGTGTGCGGGGGTGATGTGTGGCGTGCGTGG
GTGTTGGCGTGGGTATTTGGTTGTGTGTTTGGCTGTTTGTGTGTTTGGCTGTTTGTGTGTGTTGTTTGTGTGACTGGCTGTTTGTGCGTCTTGAGCGCGT
CGATTGTGGTGCGGTTTGGGTTGGTATGTGGGCGCTTAGCTCAAATGGTAGAGCGCCCGCTTCGCAGATGAGAAAGTTGAAATCAAGATTGCTATCTTTA
AACTGATCAAGGTGAGATTCTTGAAGGTTGCCCGTACGGAGCGGGGATGGACCTCTGCGGCGGTGATCGGTGCCGGAGCTTCTGTTGTCGGAGCAGACGT
GGTGGTATGCTGCCTGCTGGAATGCCGACTGTTGGTAGGACATGGTGAACTGGGACTGCAAGTCGAACGTGTAGAGACCGAAGGTCTGTTCGCACAGCTC
CGACTCGCTGAGCGTGTCGAAGAACTGGAATTAGAACTTCTTGCTGAGCAAGCTGCTCCACTGCTTGTACGCGCTGTAGAAGATCTGCTCGCCCTATAGC
TACCAGTGTTACCCGAGGACGAGCCGCTGGACGGCCAACTGGTCTCCGTGAGCAGCAGTTTATCGCCGAAGCTCATCATGATCTGCCACTGCTTGTCCAC
GACGTCGATGGCGGCAAAAGGAGAGCACACCCCAGCAATGTATACATTTCTATCCCGTCAAATTCCATAATTCTCAGAAATACTCTTTTGATTATTTGCT
TATGAAGTGTTGAACGGATTCGAGGCGTGATCTGCCATTACAAACTATGAGCCGCAACTGTCGTCTCGCAGAGAACGACTCCACTCAGATGTCCACCACG
AGCGTGGGGCGCCAGCGTCGACGCGCAGAGGACGATACCACCCCACAGGTCCCTAACCGGCGACGCAAAGATGGCTGCGCACTGGGAAACCCAAATGTCA
AGCGAGCAATTGTGCGAGGCAAGAAATCGTGCGCCATTCTGTTCAGTAGCCCGACTTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACATGTG
CGCACGTGTATGAGGAAGCGTAGGAGTATTTAACTTAAGTTCAGTATACTTGTATCCACAAGTA