Description :
From Genome Similarity Track
Location :
Scaffold_1050:1343- 2782
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_1050-fgenesh-gene-0.3E3 SUMO protein ligase NSE2
Pytap_DAOMBR444maker-pag1_scaffold_1050-fgenesh-gene-0.0COP9 signalosome complex subunit 7

Sequence
1439 bases(100 bases per row)
ACCGTCGAGCAATCAGCACTTCCATCTCGACGTCGCGCTCCAAATCGTTCAGTgTCAAACGCTGAGGACAACCTAAAAGGCAAAATCCATTTCAGACAAC
GTGTTCATGAAGAGTGAAGAGAGAGAGATCAACGCACCGGCAACTGGGCAGGCTCTGCTCTTCTTCAGGTGCGACTTAATGCCTTGTTCGGAGTATGTGT
GACCGCATGCAGGGCTACACGCAAGCAGACACTCAACATCCACAGTATctCATTCACCCATGGGCCCAACACGTACTTTCGAAGCGGATTCTCAATCTCC
AACTGTGTGACCGGACACACGGTGCTGCGTGTGCTCTCACTGTCTTGAAGGACGAGGTCAGCGTCGTCGTCCATTTCCAGCTCGATCTGTCCAATAGCAC
CGTGTCACTTCCTTACGGTACTTCCAGGTACGCATCCAGTCCTACGTACTCCAGCTTTGTCGCAGAAGCGCTTGTACAGATCGTGCGCCGTGACGTTGAT
CTTCGGCTTGGCCATACTCGTCTTGACGAGCTTGTCAAAATCGGCCGGGTCCTAGGTTGCGCTCCTATCAGCCCGTATCCTCAACCGCTGTCGTACATGC
ACATACCAATGCGCCCTTCTCAATAGCGCCTTCCATTTTcTCTAGCGCTGCCTTGTAGGCGTTtACCTGTGCCTCCAGCaCGATCAACTCCTTGGTCGTG
GCCTCGAGCGTCTGCATGTGGTCGTCGTCGGCGTAGTCTTTGAGCATCCCCGCGTTGGTCGCCAGCGCCTCGACGCTCTCGAGCACATACTTGCGCATCT
CGTAGTTCTGCTTCTTGGCCGTGTACAGCGCCATCTTGAGGGCGCTGGGCATCGCCCGCTGGATGTTGGCGTCCAGTTCGGCGTCCATGTTGCCTCCCTT
GGTGGTTGTTGGTGAAATTGCCGCCAAAATGTGTTTCCTGCTTTTGATTGGCTGAAATGTGTTGATCAGATACAAACCGACATGGTACGAACCGGGTCAA
CCCACCCCAAGCCCCCTTGTGGTTCACTTGAGGAAGGAACATGGCGTTTGAAGAAGCAGGTACCGCGAGTCTCGAGCAGTTCACGCTCCTGGCCAAGAAC
GCGCGCGGTCGTGCATGTGTGGCGCTCATCCAACAGGCGCTCTCCAACAAGAAGCTCTTTGTTTTCCGTGAGCTGCTGGACATGCCGAATGTGCAGGCGC
TGCGTGGCACCGAGCACGACGGATACTTGGAGCTGCTCGAGATCTTTAGCTTCGGCAAGTTCAGCGACTATACAGGTTCGTGGGCATGTACCTGAAGACA
ATTACCAGTATGGGTGTTAACCGAGATGATTGGTCAACCGTGTCCAgcgAAGAAAGACACGCTTCCAGCACTCACGCCGTCACAGGAGCAAAAGCTACAC
AAGCTTACTACACTTTCGCTtGCTCAACAGTCCAAGGTA